We narrowed to 5,610 results for: crispr cas9 grna plasmid
-
Plasmid#180437PurposePlasmid to express Cas9 from S.pyogenesand CRISPR gRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertgRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9/CD4-TK2
Plasmid#104397PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.DepositorInsertTK2 (TK2 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
UseTagsExpressionMammalianMutationn/aPromoterCMV and U6Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-single(U6-sgRNA(backbone))-ITR
Plasmid#207880PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6 and short human rhodopsin promoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASExpressionMutationPromotercTNTAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianMutationPromoterAvailable sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CRISPRi-sgRNA
Plasmid#221135PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with dCas9 handle
UseCRISPRTagsExpressionBacterialMutationPromoterJ23119(SpeI)Available sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2
Plasmid#240865PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianMutationPromoterGfaABC1DAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
Plasmid#240094PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianMutationPromoterGfaABC1DAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LF901: pMAGIC (L1-R5) mU6::SaCas9 gRNA scaffold
Plasmid#121811PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori
Plasmid#234737PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.DepositorInsertNrl (Nrl Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorInsertgRNA targeting human TBK1 (TBK1 Human)
UseTagsExpressionMammalianMutationPromoteru6Available sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianMutationPromoterAvailable sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHBS952 TARDBP-Exon1-ko-sgRNA1-SpCas9
Plasmid#107857PurposeTo knock-out TDP43DepositorInsertgRNA against TARDBP (Exon 1) (TARDBP Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only