We narrowed to 893 results for: gcat
-
Plasmid#90848Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R2BDepositorInsertPPP2R2B (Guide Designation B6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001487050)
Plasmid#77956Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 gRNA (BRDN0001145828)
Plasmid#76489Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgSat-MTSb/BFP/pdCas9-C1
Plasmid#162761PurposeExpressing dCas9 and sgRNA containg MTSa targeting centromeresDepositorInsertdCas9 and sgRNA(SL2-sgSat-MTSb)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
BRD2 gRNA (BRDN0001148966)
Plasmid#77985Purpose3rd generation lentiviral gRNA plasmid targeting human BRD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRB gRNA (BRDN0001147806)
Plasmid#77059Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB.DEST-ITGB1(WT)-mRuby2
Plasmid#215448PurposePiggybac expression vector with integrin beta1 tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationSilent mutations added to disrupt shRNA binding a…PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Sxl].1046B
Plasmid#112692Purposeexpress two gRNA targeting bTub & Sxl under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] and U6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode19
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 2
Plasmid#193587PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 2 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
csr-1_qa-2_dsimpα_bar
Plasmid#251402PurposeEnables inducible expression of double-stranded RNA targeting importin α (NCU01249) under the control of the qa-2 promoter, with the expression cassette inserted at the csr-1 locus.DepositorInsertimportin alpha
UseRNAiAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#1-hygro
Plasmid#254678Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only