We narrowed to 12,378 results for: shRNA
-
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHK002.2
Plasmid#235461PurposeMessage phagemid carrying sgRNA2 (prom. J23119, backbone pBR322)DepositorInsertsgRNA2
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pG1
Plasmid#162602PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUPER TBK1
Plasmid#26210DepositorInsertpSUPER TBK1 (TBK1 Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS300
Plasmid#22846PurposeBackbone for expressing plant artificial miRNAsDepositorAvailable SinceJan. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-dCas9
Plasmid#125687PurposeGene knockdown for actinomycetesDepositorInsertstreptomyces codon optimized spdCas9, sgRNA casette
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6.3>Control.gRNA.f+e
Plasmid#99140PurposeControl gRNA under the regulation of an optimized chicken specific U6 promoterDepositorInsertControl gRNA
UseCRISPRPromoterChicken U6.3Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-MCS
Plasmid#185594PurposeControl lentivector that can be used to express inserts from the PGK promoter and/or shRNA cassettes from U6.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVCT-tTR-KRAB
Plasmid#11643PurposeTet-regulated (Tet-on) lentiviral vector for transgene (CAG promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInsertCAG promoters, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #2
Plasmid#202757PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #1
Plasmid#202756PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDD426
Plasmid#202079PurposeFrame +1/-0 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +1/-0 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD427
Plasmid#202080PurposeFrame +2/-1 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +2/-1 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYS19
Plasmid#202084PurposeFrame -2 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame –2 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
px459 sgFIP200
Plasmid#175024PurposeCRISPR-Cas9 plasmid targeting exon 3 of human FIP200.DepositorInsertRB1CC1 (RB1CC1 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA2 TKIT
Plasmid#169442PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
vHB8
Plasmid#193454PurposeExpression of GFP-Cas9-NLS and gRNA in A. castellaniiDepositorInsertGFP-Cas9-NLS
UseCRISPRTagsGFPPromoterGAPDHAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only