We narrowed to 26,950 results for: gfp
-
Plasmid#32909PurposeMammalian expression construct driving the expression of a fluorescent fusion protein consisting of EGFP linked to the N-terminus of mouse neurofilament protein MDepositorAvailable SinceNov. 29, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pKLV-EF1aGFP-W
Plasmid#159291PurposeLentiviral vector expressing GFP driven by human EF1a promoterDepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterhuman EF1a promoterAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
MuHKII-pGFPN3
Plasmid#21922DepositorInsertMutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKII cDNA sequence …Available SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP
Plasmid#63215PurposeExpression of eGFP in bacteria and in mammalian cells. Used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianPromoterCMV-EF1α hybrid (CEF)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 GFP V3
Plasmid#226962PurposeCBh-SaCas9-2A-GFP, and hU6-sgRNA (Sa) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
ExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Nsp12
Plasmid#165117Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG5-EGFP
Plasmid#49246Purposeencodes enhanced green fluorescent protein (EGFP)DepositorInsertEGFP
ExpressionMammalianPromoterSV40Available SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-E1b:eGFP-Ds
Plasmid#102417PurposeFluorescent vector for screening enhancer elements in zebrafishDepositorInsertE1b:eGFP
ExpressionBacterialPromoterZebrafish E1b minimal promoterAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCG_IFITM1-IRES_eGFP
Plasmid#179958PurposeExpression vector for human IFITM1. Co-expresses GFP controlled by an IRES element.DepositorAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-2xbiRhoBAST
Plasmid#196349PurposeExpression of mEGFP mRNA with 2xbiRhoBAST in 3'UTRDepositorInsertmEGFP-2xbiRhoBAST
ExpressionMammalianPromoterCMVAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1-Spop
Plasmid#128872PurposeFor mammalian expression of mouse SpopDepositorAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
TrHKII-pGFPN3
Plasmid#21921DepositorInsertTruncated human HKII cDNA (lacking the sequence encoded by exon 1, which is the mitochondrial binding domain) in pGFP-N3 plasmid (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKII cDNA sequence (l…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
SAFB1-EGFP
Plasmid#32746DepositorAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PTEN
Plasmid#110181PurposeExpression of PTEN tagged with EGFPDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-GIT1
Plasmid#15226DepositorInsertG protein coupled receptor kinase-interacting protein 1 (GIT1 Human)
TagsGFPExpressionMammalianMutationL425V, E476K and L583PAvailable SinceSept. 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CB7.CI.eGFP.WPRE.rBG
Plasmid#105542PurposeAAV expression of EGFP from CB7 promoterDepositorHas ServiceAAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVExpressionMammalianPromoterCB7Available SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-hYAP2
Plasmid#17844DepositorAvailable SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Nsp7
Plasmid#165112Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only