We narrowed to 18,548 results for: Mut
-
Plasmid#60801PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LMBRD2 3' UTR and mutated miR-155 sitesDepositorInsertLMBRD2 3'UTR and mutated miR-155 binding site (LMBRD2 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE3331
Plasmid#107536PurposeExpresses Fn crRNA and human codon optimized FnCpf1(RVR mutant) in mammalian cells.DepositorInsertsFn crRNA
hFnCpf1(RVR mutant)
Tags3xHA and NLSExpressionMammalianMutationN607R, K613V, N617RPromoterCMV and human U6Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CARMA2sh-E142G
Plasmid#97070PurposeExpresses Psoriasis-Linked mutant CARD14/CARMA2 in mammalian cellsDepositorInsertCARD14 isoform 3 (CARD14 Human)
TagsHAExpressionMammalianMutationchanged Glutamic Acid 142 to GlycinePromoterCMVAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(A5,8,12,16)-HaloTag-FRT
Plasmid#247455PurposeExpresses wild-type H4(A5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(A5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(Q5,8,12,16)-HaloTag-FRT
Plasmid#247454PurposeExpresses wild-type H4(Q5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(Q5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(R5,8,12,16)-HaloTag-FRT
Plasmid#247453PurposeExpresses wild-type H4(R5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(R5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_H0-ABD+
Plasmid#234554PurposeCTNNA1 M-domain deletion mutant with enhanced actin-binding domain mutationsDepositorAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)
Plasmid#215451PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF)DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
A1-LCD allW D262V
Plasmid#234616PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD allW D262N
Plasmid#234615PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262N with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262N (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-n'Cas9-BE4max
Plasmid#216730PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and n'Cas9 (Cas9 with H840A mutation) in mammalian cells.DepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_ATP10B-E993A
Plasmid#203698Purposeexpresses ATP10B with the pathogenic mutation E993ADepositorAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_ATP10B-E210A
Plasmid#203697Purposeexpresses ATP10B with the catalytic mutation E210ADepositorAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_ATP10B-D433N
Plasmid#203696Purposeexpresses ATP10B with the catalytic mutation D433NDepositorAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_ATP10B-V748L
Plasmid#203702Purposeexpresses ATP10B with the pathogenic mutation V748LDepositorAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_ATP10B-I1038T
Plasmid#203700Purposeexpresses ATP10B with the pathogenic mutation I1038TDepositorAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_ATP10B-R153X
Plasmid#203701Purposeexpresses ATP10B with the pathogenic mutation R153XDepositorAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only