170,187 results
-
Plasmid#86045Purposehuman Soluble Flt1 isoform e15a (terminates in exon 15a)DepositorInserthuman soluble Flt1 isoform e15a (FLT1 Human)
Tags6xHis and V5ExpressionMammalianMutationisoform e15a (terminates in exon 15a)PromoterCMVAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pBpF
Plasmid#31190PurposetRNA synthetase/tRNA pair for the in vivo incorporation of a photocrosslinker, p-benzoyl-l-phenylalanine into proteins in E coli in response to the amber codon, TAG.DepositorInsertM.j. p-benzoylphenylalanine RS (2 copies +tRNA)
ExpressionBacterialMutationY32G, E107P, D158T, I159SAvailable SinceDec. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
mNeonGreen-mTurquoise2
Plasmid#98886PurposeProduces a fusion between mTurquoise2 and mNeonGreen. It can be used as a positive control for FRETDepositorInsertmNeonGreen-mTurquoise2
ExpressionMammalianPromoterCMVAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-Mito-7
Plasmid#57773PurposeLocalization: Mitochondria, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDNA3.1-FLAG-SF3B1-WT
Plasmid#82576PurposeExpresses a codon-optimized ORF of human SF3B1 (wild-type)DepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
GSK3 beta pGEX
Plasmid#15898DepositorAvailable SinceNov. 1, 2007AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-EF1a-IRES-Blast
Plasmid#85133Purposelentiviral backboneDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralPromoterEF1aAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB104
Plasmid#68558PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsGUSExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-centrin-1
Plasmid#72641PurposeThe plasmid encodes centrin-1 with an N-terminal EGFP tagDepositorAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-CD19 puro
Plasmid#196634PurposeExpress CD19DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_TRE3G_mCherry_WPRE_PGK_tagBFP
Plasmid#231952PurposeLentiviral vector for inducible expression of the red fluorescent protein mCherry (TRE3G promoter) and constitutive expression of the blue fluorescent protein tagBFP (PGK promoter)DepositorInsertmCherry
UseLentiviralAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Bsd-CMV>tTS/rtTA:T2A:{cymR}
Plasmid#236251PurposeBlasticidin selected lentiviral vector with Tet-On regulatory proteins and the cumate repressor, for use with dual-inducible CymR-CuO systemDepositorInsertstTS/rtTA
cymR
UseLentiviralExpressionMammalianMutationrTS and rtTA_M2 linked by T2APromoterCMVAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIN-PAmCherry-KFERQ-NE
Plasmid#102365PurposeLentiviral overexpression of PA-mCherry-KFERQ fusionDepositorInsertsPA-mCherry
KFERQ peptide
UseLentiviralTagsNEExpressionMammalianPromoterEF-1aAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1α-Dest
Plasmid#133299PurposeThe pT3-EF1α destination vector without any insert which can be used for LR reaction.DepositorTypeEmpty backboneExpressionMammalianPromoterEF1αAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-RLuc8.6-535
Plasmid#87125PurposeMammalian expression vector expressing red shifted variant of the reporter gene-Renilla luciferase (Rluc8.6)DepositorInsertRenilla Luciferase
ExpressionMammalianMutationRLuc8/ A123S/D154M/E155G/D162E/I163L/V185L.PromoterCMVAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Gi3-CASE
Plasmid#168122PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi3. Composed of the subunits G alpha i3 (GNAI3) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A114/E115 within GNAI1Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTY-EF1a-Hoxa9-p2a-MeisI-p2a-GFP
Plasmid#61738PurposeExpress Hoxa9 and MeisI to induce leukemic transformation. GFP label transduced cells.DepositorInsertHoxa9-MeisI-GFP
UseLentiviralPromoterEF1aAvailable SinceMarch 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDG1-PHP.eB
Plasmid#220799PurposeAAV helper plasmid expressing E4, E2A, VA, AAV2 rep and PHP.eB cap genesDepositorInsertE4, E2A, VA, AAV2 rep and PHP.eB cap genes
UseAAV; Aav helper vectorExpressionMammalianAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NLS-iPASnFR-L-mScarlet3-3xFLAG
Plasmid#225246PurposeMammalian expression of iPASnFR-L in the nucleusDepositorInsertiPASnFR-L
Tags3xFLAG and mScarlet3ExpressionMammalianAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only