We narrowed to 13,316 results for: ache
-
Plasmid#24525DepositorInsertCLASP2 (340-1084) 9xS/A (CLASP2 Human)
UseAdenoviralTagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant. M…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
p-super-retro puro RhoGDI2 shRNA
Plasmid#58897Purposeproduces an shRNA against RhoGDI2DepositorAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-iGluSnFR.S72A
Plasmid#106188PurposeWeak affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-iGluSnFR.S72A
UseAAVMutationGltI: S72APromoterCAGAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-EGFP-CLASP2 340-1084 9xS/A
Plasmid#24384DepositorInsertCLASP2 (340-1084) 9xS/A (CLASP2 Human)
TagsEGFPExpressionMammalianMutationNonphosphorylatable CLASP2 deletion mutant. M…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLAP-MIS12-KARD
Plasmid#114057Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 p37 deltaUBX
Plasmid#113504PurposeBacterial expression of GST-tagged p37 lacking the UBX domainDepositorInsertp37 (Ubxn2b Mouse)
TagsGST-PreScission protease siteExpressionBacterialMutationdelta 251-331 (stop codon behind AA250)Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75234PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75235PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (2/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKK-mVenus-TEV
Plasmid#105774PurposeExpression of your protein of interest in fusion with yellow fluorescent protein at the N-terminus (cleavable by TEV). Useful for FRET experiments (PMID: 11753368, 17040988, 22264545).DepositorTypeEmpty backboneUseFlp-in competentTagsmVenus-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Neo-TmiR-Gb2
Plasmid#25744PurposeControl lentiviral vector with Tet-based inducible expression of mouse G beta 2 miR30-based shRNA, constitutive Neomycin resistance gene coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-HK2-3xFLAG
Plasmid#239243PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains silent mutations introduced to ab…PromoterCMVAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-HK1-3xFLAG
Plasmid#239247PurposeHK1 lentiviral overexpression vectorDepositorInsertHK1 (HK1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the following silent mutations (c…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK2 (D209A, D657A)-3xFLAG
Plasmid#239251PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK1-3xFLAG
Plasmid#239252PurposeHK1 lentiviral overexpression vectorDepositorInsertHK1 (HK1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-HK2 (delta MBD)-3xFLAG
Plasmid#239254PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-MBD1-HK2-3xFLAG
Plasmid#239255PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4804
Plasmid#249320PurposeExpresses Non-targeting sgRNA and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertnontargeting sgRNA
ExpressionBacterialMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5740
Plasmid#249327PurposeExpresses sgRNA targeting the fcy gene in S. cerevisiaeDepositorInsertsgRNA targeting fcy
ExpressionYeastMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-RVdG-MCP:oScarlet-KASH_NoMBS
Plasmid#231014PurposeCVS N2c RVdG genome plasmid, utilized to generate negative control virus to benchmark the utility of MS2 tagging for capture of barcodes using snRNA-seq.DepositorInsertMCP-oScarlet-KASH
UseNeurotropic virusTagsKASH and MCPAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUltra-EGFP-P2A-Tr-NRL
Plasmid#239100PurposepUltra-EGFP bi-cistronic lentiviral vector expressing EGFP and truncated NRL.DepositorArticleInsertNeural Retina Leucine Zipper (truncated) (NRL Human)
UseLentiviralAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-deLACCO1-COBRA
Plasmid#223344PurposeBiosensor for extracellular L-lactateDepositorInsertdeLACCO1
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-eLACCO2-COBRA
Plasmid#223345PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-eLACCO2.1-COBRA
Plasmid#223346PurposeBiosensor for extracellular L-lactateDepositorInserteLACC02.1
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-IgK-R-eLACCO2-COBRA
Plasmid#223348PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-C-EF1α-Tr-NRL
Plasmid#239096PurposeExpresses truncated NRL, driven by EF1α promoter.DepositorArticleInsertNeural Retina Leucine Zipper (truncated) (NRL Human)
ExpressionMammalianAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-C-EF1α-FL-NRL
Plasmid#239095PurposeExpresses full length NRL, driven by EF1α promoter.DepositorArticleInsertNeural Retina Leucine Zipper (NRL Human)
ExpressionMammalianAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPPH1 (pAVA3586)
Plasmid#239328PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1 (RPPH1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
V2R untagged
Plasmid#208911Purposeencodes the human vasopressin receptor 2, without any tagsDepositorInsertAVPR2 (AVPR2 Human)
ExpressionMammalianAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
V1bR untagged
Plasmid#208925Purposeencodes the human vasopressin receptor 1b, without any tagsDepositorInsertAVPR1B (AVPR1B Human)
ExpressionMammalianAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP795
Plasmid#235700PurposeProtein expression His-taged HsNRBF2_FL in bacteriaDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (GEA)
Plasmid#228193PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (ACOCB)
Plasmid#228194PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP796
Plasmid#235701PurposeProtein expression of His-tagged HsNRBF2 MIT domain in bacteriaDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW378 (ZNF35/ZNF250tarv3-6bp spacers)x4-H2B-GFP
Plasmid#236134PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with four ZNF35/ZNF250 bindi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW411 (UTRN-43-5bp spacer-UTRN-14)-H2B-GFP
Plasmid#236148PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the UTRN promoter region encompassing 14 to 67 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the UTRN promoter regionAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW407 (ZNF35/ZNF35-6bp spacers)x4-H2B-GFP
Plasmid#236137PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with four ZNF35/ZNF250 bindi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(335-406)-H2B-GFP
Plasmid#236151PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 335 to 406 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW387 (ZNF35/IKZF1tar-6bp spacers)x4-H2B-GFP
Plasmid#236138PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with four ZNF35/ZNFIKZF1 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with four ZNF35/ZNFIKZF1 bin…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBX_RPS8_smRuby2_HA
Plasmid#236089PurposeConstitutively encodes RPS8-smRuby2-HA (mRuby2-based spaghetti monster fluorescent protein embedding HA epitope tags), for targeting RPS8 in the 40S subunit.DepositorInsertRPS8-smRuby2-HA (RPS8 Human, Synthetic)
ExpressionMammalianAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAND1-AM-Tag-PGK-Neo
Plasmid#223216PurposeTargeting plasmid for inserting a C-terminal AM-Tag in the human HAND1 geneDepositorAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_6xHis-TEV-mCherry-WIPI2d IDR (364-425aa)
Plasmid#223790PurposeExpression of recombinant protein for purificationDepositorInsertWIPI2d IDR (WIPI2 Human)
Tags6xHis-TEV-mCherryExpressionBacterialMutationaa 364-425 onlyAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-mEGFP-WIPI2 IDR (364-425aa)
Plasmid#223758PurposeStable expression and inducible recruitment of protein in mammalian cell cultureDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_6xHis-TEV-mCherry-WIPI2d (K87A/K88A)
Plasmid#223751PurposeExpression of recombinant protein for purificationDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1_GST-LC3C
Plasmid#223727PurposeExpression of recombinant protein for purificationDepositorInsertLC3C (MAP1LC3C Human)
TagsGSTExpressionBacterialMutationaa 2-126 only, with Glycine exposedAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only