We narrowed to 3,270 results for: actin
-
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-MYC GAC F7
Plasmid#227828PurposeTo amplify the virus that expresses C-MYC GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
UseLentiviralTagsMYCExpressionMammalianMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GAC F7
Plasmid#227829PurposeTo express in E. coli GAC F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertGAC isoform of F7 (GLS Human)
TagsGSTExpressionBacterialMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHM1 KGA-33A
Plasmid#227836PurposeUsed for microinjection of nematodes for expression of KGA-33A, GLS with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform (GLS Human)
TagsGFPExpressionWormMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX KGA F7
Plasmid#227822PurposeTo express in E. coli KGA F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform of F7 (GLS Human)
TagsGSTExpressionBacterialMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-MYC KGA F7
Plasmid#227821PurposeTo amplify the virus that expresses C-MYC KGA F7 with 33 residues mutated to alanine at the interface for interacting with PDZD8DepositorInsertKGA isoform of F7 (GLS Human)
UseLentiviralTagsMYCExpressionMammalianMutationP137, L139, E140, L142, Y145, G150, Q151, E152, K…Available SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hAP1-C-LAMP2 TM
Plasmid#183645PurposeLentiviral expression of a mutant of ATP6AP1 with its PEN2-interacting domain replaced with the transmembrane (TM) domain of LAMP2.DepositorUseLentiviralTagsHAMutationATP6AP1 transmembrane domain replaced by the tran…PromoterCMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS SARS-CoV-2 BA.1 Spike
Plasmid#185452PurposeExpresses codon-optimized full length SARS-CoV-2 BA.1 SpikeDepositorInsertSARS-CoV-2 Spike BA.1 (S )
ExpressionMammalianMutationContains the following mutations: A67V, Δ69-70, T…Promoterchicken β-actin promoter, CMV enhancerAvailable SinceJune 8, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS SARS-CoV-2 BA.2 Spike
Plasmid#185604PurposeExpresses codon-optimized full length SARS-CoV-2 BA.2 SpikeDepositorInsertSARS-CoV-2 BA.2 Spike (S )
ExpressionMammalianMutationT19I, L24S, Δ25-27, G142D, V213G, G339D, S371F, S…Promoterchicken β-actin promoter, CMV enhancerAvailable SinceJuly 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits