We narrowed to 5,762 results for: Chia
-
Plasmid#102626PurposeExpresses c-Myc in mammalian cellsDepositorInsertMYC proto-oncogene, bHLH transcription factor (MYC Human)
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS2-TEV-Twin-Strep
Plasmid#202529PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 2 (SMS2) in mammalian cellDepositorInsertSGMS2 (SGMS2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TGA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPN089
Plasmid#91614PurposeExpress sgRNA targeting human FURINDepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-SMS1-TEV-HAT
Plasmid#202557PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable HAT-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsHistidine-Affinity-tag (HAT) and TEV cleavable si…ExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-puro-EWS-FLI1
Plasmid#102813PurposeOverexpress EWS-FLI1. 3rd generation lentiviral vector.DepositorAvailable SinceNov. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICE-RNaseHI-WT-NLS-mCherry
Plasmid#60365PurposePlasmid for expression of bacterial RNase HI tagged with NLS-mCherry that can be used to degrade R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI
TagsNLS from SV40 T antigen and mCherryExpressionMammalianPromoterCMV-tetAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBP Omomer
Plasmid#113169PurposeRetroviral vector for expressing Omomer (tamoxifen inducible Omomyc), by DNA transfection or retroviral infection.DepositorInsertOmomer: a fusion contruct of Omomyc and MER (a mutant estrogen receptor, reponsive to tamoxifen) (MYC Human)
UseRetroviralExpressionMammalianMutationE57T, E64I, R70Q, R71NAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKT-CNP-inact
Plasmid#211804PurposeExpresses inactive 2',3'-cyclic nucleotide phosphodiesterase catalytic domain (catalytic residues mutated)DepositorInsert2',3'-cyclic nucleotide phosphodiesterase catalytic domain (Cnp Rat)
ExpressionBacterialMutationH73L H153LPromotertetAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-VP64-Puro
Plasmid#99371Purpose3rd generation lenti vector encoding dCas9-VP64 with 2A puromycin resistance marker (EF1a-dCas9-VP64-T2A-Puro-WPRE)DepositorInsertdCas9-VP64-T2A-Puro
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 myc-Rab10
Plasmid#208366PurposeMammalian expression of myc-tagged human Rab10DepositorAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mAtp5c-2
Plasmid#198480Purposelentiviral stable expression of mAtp5c gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCert1-1
Plasmid#198487Purposelentiviral stable expression of mCert1 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mPHB2-1
Plasmid#198483Purposelentiviral stable expression of mPHB2 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mHgs-2
Plasmid#198482Purposelentiviral stable expression of mHgs gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCct8 - 1
Plasmid#198503Purposelentiviral stable expression of mCct8 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
eMscL WT
Plasmid#107454PurposeeMscL WT is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia Coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianPromoterhuman synapsin 1Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSFDUET-1_VNp-anti-Lysozyme fAb-BiFC
Plasmid#214950PurposeBacterial expression of anti-chicken lysozyme Fab light and heavy chain VNp fusions. Each chain is fused to separate halves of a BiFC protein -Venus fluorescence signifies Hc/Lc heterodimer formation.DepositorInsertsVNp-anti-Lysozyme Fab heavy chain amino-BiFC fusion
VNp-anti-Lysozyme Fab light chain amino-BiFC fusion
Tags6xHis, Amino half of venus BIFC fragment, Carboxy…ExpressionBacterialPromoterT7Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pScalps_Puro_mCebpa
Plasmid#79551PurposeExpression of mouse CebpaDepositorInsertCebp alpha (Cebpa Mouse)
UseLentiviralAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-pro-alphaf(I)-E2-Crimson
Plasmid#117660PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-pro-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only