We narrowed to 8,604 results for: Ott
-
Plasmid#185152PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-187_noLink. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS2_PARRC_98-187_noLink
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_RAMVA (pBS0267)
Plasmid#185150PurposeFor the mammalian expression of the tardigrade protein CAHS1_RAMVA. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_RAMVA
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
SAHS4_HYPDU pSecTag2(pm) (pBS0266)
Plasmid#185149PurposeFor the mammalian expression of the tardigrade protein SAHS4_HYPDU. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertSAHS4_HYPDU
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Q9Y043_CAEEL pSecTag2(pm) (pBS0265)
Plasmid#185148PurposeFor the mammalian expression of the C. elegans protein Q9Y043_CAEEL. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ9Y043_CAEEL
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS1_PARRC_Boothby pSecTag2(pm) (pBS0258)
Plasmid#185147PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_PARRC
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
B9VQB0_ARTSF pSecTag2(pm) (pBS0257)
Plasmid#185146PurposeFor the mammalian expression of the brine shrimp protein B9VQB0_ARTSF. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertB9VQB0_ARTSF
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
A0A1D1UNQ6_RAMVA pSecTag2(pm) (pBS0256)
Plasmid#185145PurposeFor the mammalian expression of the tardigrade protein A0A1D1UNQ6_RAMVA. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertA0A1D1UNQ6_RAMVA
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Dehydrin_Q84N45_9LILI pSecTag (pBS0255)
Plasmid#185144PurposeFor the mammalian expression of the xerophyta (Xerophyta zambiana) protein Dehydrin_Q84N45_9LILI. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDehydrin_Q84N45_9LILI
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LEA1_APHAV_Chakrabortee pSecTag (pBS0254)
Plasmid#185143PurposeFor the mammalian expression of the nematode (Aphelenchus avenae) protein LEA1_APHAV. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertLEA1_APHAV
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAHS_RAMVA_Tanaka pSecTag (pBS0253)
Plasmid#185142PurposeFor the mammalian expression of the tardigrade protein MAHS_RAMVA. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertMAHS_RAMVA
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
SAHS10_A0A1D1UJR2_RAMVA pSecTag (pBS0250)
Plasmid#185140PurposeFor the mammalian expression of the tardigrade protein SAHS1_A0A1D1UJR2. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertSAHS1_A0A1D1UJR2
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_MAHS_RAMVA_mts_1-81 (pBS0918)
Plasmid#185287PurposeFor the mammalian expression of the tardigrade protein MAHS_RAMVA_mts_1-81. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertMAHS_RAMVA_mts_1-81
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_MAHS_RAMVA_mts_1-74 (pBS0917)
Plasmid#185286PurposeFor the mammalian expression of the tardigrade protein MAHS_RAMVA_mts_1-74. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertMAHS_RAMVA_mts_1-74
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AfrLEA2 (pBS0910)
Plasmid#185284PurposeFor the mammalian expression of the brine shrimp protein AfrLEA2. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAfrLEA2
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_H2FLK5_CAEEL_30-800 (pBS0864)
Plasmid#185283PurposeFor the mammalian expression of the synthetic protein H2FLK5_CAEEL_30-800. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertH2FLK5_CAEEL_30-800
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_R163C (pBS0842)
Plasmid#185276PurposeFor the mammalian expression of the human protein APOE_HUMAN_R163C. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_R163C
UseTagsExpressionMammalianMutationR163CPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_V153N (pBS0824)
Plasmid#185270PurposeFor the mammalian expression of the human protein APOE_HUMAN_V153N. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_V153N
UseTagsExpressionMammalianMutationV153NPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_TsDHN-2 (pBS0806)
Plasmid#185265PurposeFor the mammalian expression of the Eutrema salsugineum protein DHN_TsDHN-2. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDHN_TsDHN-2
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_CsLEA11 (pBS0786)
Plasmid#185255PurposeFor the mammalian expression of the Cucumber protein DHN_CsLEA11. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDHN_CsLEA11
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DHN_AmDHN132 (pBS0781)
Plasmid#185253PurposeFor the mammalian expression of the Ammopiptanthus protein DHN_AmDHN132. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDHN_AmDHN132
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_TJ190_negative (pBS0773)
Plasmid#185250PurposeFor the mammalian expression of the synthetic protein TJ190_negative. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertTJ190_negative
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_SAHS4_k1_0 (pBS0769)
Plasmid#185249PurposeFor the mammalian expression of the tardigrade protein SAHS4_k1_0. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertSAHS4_k1_0
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k5_15 (pBS0767)
Plasmid#185248PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_15. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertPvLEA4_repeats_k5_15
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k5_1 (pBS0766)
Plasmid#185247PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertPvLEA4_repeats_k5_1
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DrHD_dom3_k5_0 (pBS0758)
Plasmid#185242PurposeFor the mammalian expression of the Deinococcus radiodurans protein DrHD_dom3_k5_0. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDrHD_dom3_k5_0
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DrHD_dom3_k3_1 (pBS0754)
Plasmid#185240PurposeFor the mammalian expression of the Deinococcus radiodurans protein DrHD_dom3_k3_1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDrHD_dom3_k3_1
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AdAPOA4-44 (pBS0745)
Plasmid#185236PurposeFor the mammalian expression of the Chinese giant salamander protein AdAPOA4-44. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAdAPOA4-44
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
HASP_HUMAN_D0
Plasmid#79730PurposeThis plasmid encodes the kinase domain of HASP. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertHASP
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KCC2D_HUMAN_D0
Plasmid#79734PurposeThis plasmid encodes the kinase domain of KCC2D. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertKCC2D
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAPK2_HUMAN_D0
Plasmid#79738PurposeThis plasmid encodes the kinase domain of AAPK2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertAAPK2
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KCC1G_HUMAN_D0
Plasmid#79745PurposeThis plasmid encodes the kinase domain of KCC1G. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertKCC1G
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KCC2A_HUMAN_D0
Plasmid#79746PurposeThis plasmid encodes the kinase domain of KCC2A. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertKCC2A
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KC1G2_HUMAN_D0
Plasmid#79716PurposeThis plasmid encodes the kinase domain of KC1G2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertKC1G2
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK03_HUMAN_D0
Plasmid#79688PurposeThis plasmid encodes the kinase domain of MK03. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertMK03
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAK4_HUMAN_D0
Plasmid#79698PurposeThis plasmid encodes the kinase domain of PAK4. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertPAK4 (PAK4 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAK6_HUMAN_D0
Plasmid#79703PurposeThis plasmid encodes the kinase domain of PAK6. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertPAK6 (PAK6 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHiUGE smFP-V5 donor (all-in-one) ORF2
Plasmid#200388PurposeTagging endogenously expressed proteins with "spaghetti monster" smFP-V5, C-terminalDepositorInsertspaghetti monster smFP-V5 (ref: PMID: 25915120, Addgene plasmid # 59758 )
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
p300dAIL KAT LIC 1M
Plasmid#233588PurposeBacterial expression of p300 KAT enzyme with truncated autoinhibitory loopDepositorInsertp300dAIL KAT (EP300 Human)
UseTags6xHis MBPExpressionBacterialMutationdeleted amino acids 1523-1554PromoterT7Available sinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV CAMKII PSAM4 GlyR IRES EGFP
Plasmid#119744PurposeChemogenetic inhibitor expression plasmidDepositorUseAAVTagsExpressionMammalianMutationL131G, Q139L, Y217FPromoterCamKIIAvailable sinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV SYN PSAM4 GlyR IRES EGFP
Plasmid#119742PurposeChemogenetic inhibitor expression plasmidDepositorUseAAVTagsExpressionMammalianMutationL131G, Q139L, Y217FPromotersynapsinAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-NFE2L2-Puro
Plasmid#181919PurposeLentiviral plasmid that directs the expression of NFE2L2/Nrf2 in mammalian cells.DepositorInsertNFE2L2 (NFE2L2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterSFFVAvailable sinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
YopH (residues 164-468)
Plasmid#79749PurposeThis plasmid encodes the active catalytic domain (amino acid residues 164-468) of YopH. Inteded for co-expression with human Tyr kinase plasmids to enhance bacterial kinase expression.DepositorInsertYopH (residues 164-468)
UseTagsExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-flex-GFP-4x6T
Plasmid#196418PurposeCre-dependent AAV expression of GFP preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertGFP
UseAAV and Cre/Lox; Astrocyte-selectiveTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-flex-iGABASnFR2-WPRE
Plasmid#218877PurposeAAV-mediated expression of improved GABA sensor (positive change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2
UseAAV and Cre/LoxTagsExpressionMammalianMutationS99A F102Y F104Y L178SPromoterSynapsinAvailable sinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHiUGE TurboID-HA donor (all-in-one) ORF0
Plasmid#200383PurposeTagging endogenously expressed proteins with TurboID-HA, C-terminalDepositorInsertTurboID (ref: PMID: 30125270, Addgene plasmid # 107169)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
VRK1_HUMAN_D0
Plasmid#79684PurposeThis plasmid encodes the kinase domain of VRK1. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorInsertVRK1 (VRK1 Human)
UseTagsHis10-TEVExpressionBacterialMutationPromoterT7Available sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti 4.1 Ex miR200c-141
Plasmid#35534Purpose3rd generation lentiviral vectorDepositorUseLentiviralTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCdOpt-BMX
Plasmid#203929PurposeThis plasmid contains a codon optimized BleMX drug resistance cassette for generating gene deletions in C. glabrata, C. auris, C. albicans or S. cerevisiaeDepositorInsertBleMX
UseTagsExpressionYeastMutationBleMX was codon optimized for Candida albicans or…PromoterAvailable sinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only