We narrowed to 4,284 results for: Abo
-
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
159_pAAV-ProD3-CatCh-GFP-WPRE
Plasmid#125979PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD3Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_12S→E_S305C/A326P
Plasmid#248868PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E, S305C and A326P.DepositorInsertTDP-43_CTD_12S→E_S305C/A326P (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S317C
Plasmid#248845PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S317C.DepositorInsertTDP-43_CTD_13S→E_S317C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_13S→E_S273C
Plasmid#248859PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with 13S→E and S273C.DepositorInsertTDP-43_CTD_13S→E_S273C (TARDBP Human)
Tags6xHis-tagsExpressionBacterialMutationchanged S292E, S305E, S369E, S377E, S379E, S387E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_12S→E_S305C
Plasmid#248867PurposeExpresses MBP-tagged C-terminal domain of TDP-43 with 12S→E and S305C.DepositorInsertTDP-43_CTD_12S→E_S305C (TARDBP Human)
Tags6xHis tags-MBPExpressionBacterialMutationchanged S292E, S369E, S377E, S379E, S387E, S389E,…Available SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB CRIV Gc Spike H6
Plasmid#240163PurposePlasmid for making PiggyBac stable cell line expressing Cristoli virus (CRIV) glycoprotein Gc spike with a C-terminal His6 tagDepositorInsertCRIV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 478-906 onlyAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMWCAVI_H6BAP-OROV_N
Plasmid#240162PurposePlasmid encoding Oropouche virus (OROV) nucleoprotein (N) with an N-terminal His6 and biotin acceptor peptide (BAP, a.k.a. AviTag) for expression in E. coliDepositorInsertNucleoprotein
Tags6xHis, Biotin acceptor peptide (BAP, a.k.a. AviTa…ExpressionBacterialAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mEtfdh-AAA6
Plasmid#232317PurposeExpression of mouse mutant Etfdh (AAA6)DepositorInsertEtfdh (Etfdh Mouse)
UseLentiviralMutationPAM Sequence Mutations: (G36C; T39C, C42T; C72T, …Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mEtfdh-AAG6
Plasmid#232315PurposeExpression of mouse mutant Etfdh (AAG6)DepositorInsertEtfdh (Etfdh Mouse)
UseLentiviralMutationPAM Sequence Mutations: (G36C, T39C, C42T, C72T, …Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166D
Plasmid#226720PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166DDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166L
Plasmid#226721PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166LDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-D195A
Plasmid#226722PurposeMammalian expression of cytosolic mouse CNDP2 mutant D195ADepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-H445F
Plasmid#226723PurposeMammalian expression of cytosolic mouse CNDP2 mutant H445FDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mEtfdh-AAA4
Plasmid#232316PurposeExpression of mouse mutant Etfdh (AAA4)DepositorInsertEtfdh (Etfdh Mouse)
UseLentiviralMutationPAM Sequence Mutations: (G36C; T39C, C42T; C72T, …Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg3_pX330
Plasmid#127340PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA (Cdk13 Mouse)
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Untagged
Plasmid#127342PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only