We narrowed to 846 results for: fos
-
Plasmid#83478PurposeMammalian expression of the dehydrogenase-deficient mutant DLD-H450A.DepositorAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307-SOD1E133insTT
Plasmid#83446PurposeMammalian expression of SOD1E133insTT.DepositorInsertSOD1 (SOD1 Human)
UseLentiviralExpressionMammalianMutationE133insTT (after GA)PromoterEF-1αAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307-SOD1E133Δ
Plasmid#83445PurposeMammalian expression of SOD1E133Δ.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133K-AcGFP1
Plasmid#83442PurposeExpresses SOD1E133K in mammalian cells.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nav1.5_1-2linker411-717_PPSYtoAASA1960-1996
Plasmid#187732PurposeExpress a chimera of the Nav1.5 linker between the first and second transmembrane domain with the motif surrounding PPSY; residues 1974-1977 PPSY mutated to AASADepositorInsertNav1.5 1,2linker residues 411-717 and Nav1.5 residues 1960-1996 PPSY mutated to AASA (SCN5A Human)
TagsHis-TEVExpressionBacterialMutationdeletion of residues 1-410 and 718-1959 and 1997-…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5K85R
Plasmid#98694PurposeGateway cloning of human PRDX5-K85RDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5K83R
Plasmid#98693PurposeGateway cloning of human PRDX5-K83RDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5E80K
Plasmid#98692PurposeGateway cloning of human PRDX5-E80KDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K85R-VA
Plasmid#98691PurposeLentiviral expression of human PRDX5-K85R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK85RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5E80K-VA
Plasmid#98689PurposeLentiviral expression of human PRDX5-E80K in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationE80KPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K83R-VA
Plasmid#98690PurposeLentiviral expression of human PRDX5-K83R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK83RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307-SOD1E133K
Plasmid#83447PurposeMammalian expression of SOD1E133KDepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133insTT-AcGFP1
Plasmid#83441PurposeExpresses SOD1E133insTT in mammalian cells.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133Δ-AcGFP1
Plasmid#83419PurposeExpresses SOD1E133Δ in mammalian cells.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS40P
Plasmid#35481DepositorTypeEmpty backboneUseYeast integrating vectorAvailable SinceNov. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
lvl0 BlpR
Plasmid#153390PurposeConfers resistance to bialaphos or phosphinothricin (Glufosinate)DepositorInsertBlpR
ExpressionPlantAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNFkB:eGFP
Plasmid#44922DepositorInsertEGFP
Available SinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
pGC629
Plasmid#71364Purposeproximal somatic gonad expression of DAF-16 in C.elegansDepositorAvailable SinceDec. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha2
Plasmid#165859PurposeAlpha2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega2
Plasmid#165861PurposeOmega2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha1
Plasmid#165858PurposeAlpha1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Omega1
Plasmid#165860PurposeOmega1 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-msfGFP
Plasmid#194913PurposeTetracycline inducible expression of msfGFP in StaphylococciDepositorInsertShine Dalgarno Sequence followed by monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2EGFP
Plasmid#239990PurposeDestabilized green fluorescent protein (d2EGFP) under transcriptional control of NF-kB activityDepositorInsertDestabilized EGFP
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2mRFP1
Plasmid#239991PurposeDestabilized red fluorescent protein (d2mRFP1) under transcriptional control of NF-kB activationDepositorInsertsmRFP1
PEST
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-sec:msfGFP
Plasmid#194914PurposeTetracycline inducible expression of msfGFP fused to Sec signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMB41
Plasmid#73087PurposeN-terminal Avi-2xTEV-GFP vector, for fosmid recombineeringDepositorInsertAvi-GFP tag
TagsAvi and GFPExpressionWormAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMB72
Plasmid#73088PurposeC-terminal GFP-2xTEV-Avi vector, for fosmid recombineeringDepositorInsertGFP-Avi tag
TagsGFP and AviExpressionWormAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGem-LP1-loxP-bar-lox2272-71
Plasmid#168785PurposeVector to create landing pad 1 (LP1) by homologous recombination in Aspergillus nidulans ΔSt site. The strain A. nidulans LP1 is used for recombinase mediated chromosomal integration.DepositorInsertsbar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
loxP
lox2272-71
UseCre/Lox and Synthetic BiologyAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGem-LP2-loxP-bar-lox2272-71
Plasmid#168786PurposeVector to create landing pad 2 (LP2) by homologous recombination in Aspergillus nidulans IS1 site. The strain A. nidulans LP2 is used for recombinase mediated chromosomal integration.DepositorInsertsbar
IS1 Homology arm 1
IS1 Homology arm 2
loxP
lox2272-71
UseCre/Lox and Synthetic BiologyAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pC-BAR-YR
Plasmid#61766PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing bar gene (for resistance against glufosinate ammonium) on transfer DNA (TDNA).DepositorInsertsBar gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromotertrpC promoterAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:Kaede
Plasmid#239992PurposeKaede driven by NFkB activity can be switched from green to red fluorescence by UV light exposure, enabling tracking of NFkB positive cellsDepositorInsertphoto convertible Kaede
TagsNAPromotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only