We narrowed to 4,936 results for: AAT
-
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210747PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210746PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 2DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210745PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A5NT
Plasmid#62263Purposeexpression of A5NT sgRNA from the arabinose-inducible promoterDepositorInsertA5NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shMYB.2652
Plasmid#105575PurposeDox-inducible mir30 MYB shRNA/dsRED expression with Venus marker and neo resistanceDepositorInsertMYB shRNA #2652
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCascade
Plasmid#140622PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and CRISPR RNADepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(entry)
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pClodANL-FGF4
Plasmid#107874PurposeBacterial expression of FGF4-NanoLucDepositorAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p15aC-4D1D-5
Plasmid#107866PurposeBacterial expression of PIS, PI4K and PI4P5KDepositorInsertsPIS
phosphatidylinositol 4-phosphate 5-kinase
phosphatidylinositol 4-kinase β
TagsmycExpressionBacterialPromoterproD and proD (in operon)Available SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJL1 Aquamarine
Plasmid#106285PurposeExpresses Aquamarine (an eCFP derivative) in Ecoli off a T7 promoterDepositorInsertAquamarine
Tags6xHis and TEV cleavage (N terminal on insert)ExpressionBacterialMutationT65S and H148GPromoterT7Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shREN
Plasmid#105586PurposeDox-inducible mir30 shREN (control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNP1 eforRed toehold switch
Plasmid#107353PurposeExpresses eforRed (an RFP derivative) in Ecoli off a T7 promoter when pNP1 eforRed trigger is co-expressedDepositorInserttoehold switch 1 + eforRed
ExpressionBacterialPromoterT7Available SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
LEP-shREN
Plasmid#105580Purposeretrovirally express control shRNA with puro resistance and GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNP1 tdTomato toehold switch
Plasmid#107354PurposeExpresses tdTomato (a DsRed derivative) in Ecoli off a T7 promoter when pNP1 tdTomato trigger is co-expressedDepositorInserttoehold switch 5 + tdTomato
ExpressionBacterialPromoterT7Available SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNP1 Aqua toehold switch
Plasmid#107356PurposeExpresses Aquamarine (an eCFP derivative) in Ecoli off a T7 promoter when pNP1 Aqua trigger is co-expressedDepositorInserttoehold switch 8 + Aquamarine
ExpressionBacterialPromoterT7Available SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISP_IS
Plasmid#120425PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3 and IS5.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shREN
Plasmid#105585PurposeDox-inducible mirE shREN(control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only