170,188 results
-
Plasmid#226825PurposeExpressing RecE*T controled by Ptrc promoterDepositorInsertrecE*T
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGSTag Flag p38 alpha
Plasmid#20815DepositorAvailable SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC4A11_STOP
Plasmid#161358PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC4A11 (SLC4A11 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
mPlum-Lifeact-7
Plasmid#54679PurposeLocalization: Actin, Excitation: 590, Emission: 649DepositorInsertLifeact-mPlum
ExpressionMammalianAvailable SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GFP
Plasmid#221469PurposeGateway cloning of GFP overexpressionDepositorInsertEGFP
UseGateway donor vectorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJL1 BSMT1
Plasmid#106287PurposeExpresses BSMT1 in Ecoli off a T7 promoterDepositorInsertBSMT1
ExpressionBacterialPromoterT7Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFH6_new
Plasmid#105866Purposemore efficient version of pFH6; Subcloning of any sgRNA via BbsI siteDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR and Synthetic Biology; SubcloningExpressionPlantAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pISceI Dusp6:D2EGFP
Plasmid#32667DepositorAvailable SinceNov. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Centrobin
Plasmid#136829PurposeMammalian expression of the centrosomal protein Centrombin N-terminally fused to SNAP-tagDepositorInsertSNAP-Centrobin (CNTROB Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
9xHRE-MinTK-CRE
Plasmid#141146Purposelentiviral expression vector to generate a hypoxia fate-mapping systemDepositorInsert9xHRE-MinTK-CRE
UseLentiviralAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEXC3GH (Kan)
Plasmid#110081PurposeAnalogous to pMINTC3GH but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH-hMALAT1
Plasmid#118580Purposeto overexpress human MALAT1 in mammalian cellsDepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT3
Plasmid#195575PurposeExpresses STAT3DepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVExpressionMammalianPromoterCMV enhancer and promoterAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NANOS3-T2A-mVenus-PuroTK
Plasmid#222903PurposeHomology directed repair template for knocking in mVenus reporter to NANOS3.DepositorInsertmVenus
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACEC3GH (Apr)
Plasmid#110085PurposeReplicative, acetamide-based expression vector containing a C-terminal 3C cleavage site and a GPF-fusion with a His10-tag. Suitable for high-level expression levels amenable for large scale purification of proteins.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
VPS35 shRNA1
Plasmid#163858PurposeshRNA targeting the coding sequences of VPS35DepositorInsertVPS35 retromer complex component (VPS35 Human)
ExpressionMammalianAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamK2-tTA
Plasmid#210731PurposeAAV vector expressing tetracycline-controlled transactivator (tTA) under CamK2 promoter (for expressing tTA in glutamatergic neurons)DepositorInserttetracycline-controlled transactivator (tTA)
UseAAVPromoterCamK2Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only