We narrowed to 12,418 results for: BASE
-
Plasmid#175062Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ25) in mammalian cellsDepositorInsertpolyQ25 (HTT Human)
UseTagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQ39-VC
Plasmid#175061Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ39) in mammalian cellsDepositorInsertpolyQ39 (HTT Human)
UseTagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-GFP KI
Plasmid#131497PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorUseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
SNX10-PX (1-201)
Plasmid#119091PurposeBacterial expression of human phox homology (PX) domain, SNX10-PX (1-201)DepositorInsertSNX10-PX (1-201) (SNX10 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…TagsExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Ptet-nCas9-BE
Plasmid#195739PurposeExpress APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coliDepositorArticleInsertTet repressor protein / APOBEC1-nCas9(D10A)-UGI
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterPtet(Tetracycline inducible protein)Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos1.0
Plasmid#73639PurposeGenome editing for gene pyrE (CAC-002) in Clostridium acetobutylicum ATCC 824DepositorInsertsCas9 nickase
sGRNA to pyrE
UseE.coli-clostridium shuttle vectorTagsExpressionMutationD10APromoterj23119 and ptbAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
SNX29-PX (269-391)
Plasmid#119108PurposeBacterial expression of human phox homology (PX) domain, SNX29-PX (269-391)DepositorInsertSNX29-PX (269-391)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV7.1_3xFLAG-LATS1
Plasmid#172986Purposeconstitutive expression of FLAG-tagged LATS1DepositorInsert3xFLAG-LATS1 (LATS1 Human)
UseTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-OB-Linker-eGFP
Plasmid#176068PurposeEGFP fused to the C-terminus of an OB domain & a hygromycin resistance cassetteDepositorInsertOB
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
JG1211: CAG-human dLbCpf1(D832A)-NLS-3xHA-VPR
Plasmid#104567PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to VPR activatorDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to HSV VPR activation domain
UseCRISPRTagsNLS-3xHA-VPRExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-FHA-Linker-eGFP
Plasmid#176065PurposeEGFP fused to the C-terminus of a FHA domain & a hygromycin resistance cassetteDepositorInsertFHA
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP304-pAAV-EFS-dSaCas9-VP64-pA
Plasmid#113679PurposeA EFS driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64ExpressionMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
NKP66 pEGFP-N2 (1176)
Plasmid#62039Purposemammalian expression of nuclear envelope transmembrane proteinDepositorInsertMARCHV (MARCHF5 Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
CD3-2A_pMI-LO
Plasmid#153418PurposeRetroviral (MSCV) expression of all four WT CD3 subunits, co-expressed with LSSmOrangeDepositorInsertmurine CD3 delta-gamma-epsilon-zeta subunits (Cd3d Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H74
Plasmid#170338PurposemTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTDel_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseTagsExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
TC1316
Plasmid#164883PurposeCMV-bpNLS-dCas13d-bpNLS-ADARdd-mCherry, ADARdd embeded in loop3DepositorInsertdcas13d-ADARdd
UseTagsExpressionMammalianMutationdCas13d L560-G586 deletedPromoterCMV, T7Available sinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi3-LgB91
Plasmid#134359PurposeNanoluc complementation assay. Expression of Gαi3 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi3. Addition of the HA epitope at N terminus of Gαi3.DepositorInsertGαi3-LgB91 (GNAI3 Human)
UseTagsHAExpressionBacterial and MammalianMutationPromoterT7Available sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
A2_uSFFV
Plasmid#153415PurposeExpresses HLA-A*02:01 MHCI gene by the UCOE-SFFV promoterDepositorInsertA*02:01-P2A-human beta2 microglobulin (B2M Human)
UseLentiviralTagsExpressionMammalianMutationPromoterSFFVAvailable sinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 S. Pyogenes, Human, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesPromoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
MYH11-gRNA1
Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR(Y107A)-Hygro
Plasmid#176073PurposeEGFP fused to the C-terminus of a WWE domain containing the mutation Tyr107Ala & a hygromycin resistance cassetteDepositorInsertLivePAR (Y107A)
UseLentiviralTagsEGFPExpressionMammalianMutationPoint mutation to convert Try107 to AlaPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Po-nCas9-BE
Plasmid#195740PurposeExpress APOVEC1-nCas9(D10A)-UGI using phenol inducible system in Methanotroph or E. coliDepositorArticleInsertDi-Methyl Phenol Regulatory protein / APOBEC1-nCas9(D10A)-UGI
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterPo (phoenol-inducible promoter)Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…TagsExpressionMutationPromoterAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos2.0
Plasmid#73228PurposeGenome editing for gene xylR (cbei-2385) in clostridium beijerinckii NCIMB 8052DepositorInsertsCas9 nickase
sgRNA to xylR
UseE.coli - clostridium shuttle vectorTagsExpressionMutationD10APromoterPj23119 and PthlAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_nV5-AMOTL2
Plasmid#172999Purposeconstitutive expression of V5-tagged AMOTL2DepositorInsertV5-AMOTL2 (AMOTL2 Human)
UseTagsV5ExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Macro-Linker-eGFP
Plasmid#176067PurposeEGFP fused to the C-terminus of a Macrodomain & a hygromycin resistance cassetteDepositorInsertMacro
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-WWE-Linker-eGFP
Plasmid#176072PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertWWE
UseLentiviralTagsEGFPExpressionMammalianMutationPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only