We narrowed to 4,337 results for: U6 gRNA
-
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
p213-SWITCH-OFF
Plasmid#217888PurposeRetroviral Switch-OFF vector for sgRNA expression; U6-BbsIx2-SWITCH-OFF-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1_Neo
Plasmid#125593PurposeLentiviral expression of sgRNA with GFP and neomycin resistance geneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for sgRNA expression and EFS promoter…Available sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre stuffer v3
Plasmid#158030Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHDR-USR-eGFP
Plasmid#208830PurposeHDR Universal Surrogate Reporter with a sgRNA and consistently expressed eGFP but without Cas9. The selective PuroR reporter gene was designed to be repaired only by the sgRNA/Cas9-triggered HDR.DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterCMV, U6Available sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS458-U6_CBA-mCherry
Plasmid#195566PurposeTransient expression of mCherry; U6 with scaffold for sgRNA cloning in mammalian cells.DepositorInsertmCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmBI
Plasmid#126028PurposePiggyBac cargo vector expressing rtTA, contains BsmBI sites for sgRNA cloningDepositorTypeEmpty backboneUseCRISPR; PiggybacTagsExpressionMammalianMutationPromoterU6Available sinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1839
Plasmid#154325PurposesgRNA Destination Vector for SapTrapDepositorInsertSapTrap sgRNA (F+E) vector, R07E5.16 U6 promoter
UseCRISPRTagsExpressionWormMutationF+E mutations in sgRNAPromoterAvailable sinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mTubb3
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-HITI
Plasmid#87117PurposeAAV backbone plasmid including GFPNLS-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 stuffer v3
Plasmid#158046Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA casette (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Cre stuffer v4
Plasmid#158032Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette with modified tracrRNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRISPR-Cre stuffer v4
Plasmid#158033PurposeLentiviral construct with Cas9, Cre recombinase and U6 driven sgRNA cassette with modified tracr RNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI)DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBA950
Plasmid#122239PurposeCROP-seq vector optimized for sgRNA expression and CRISPRi activity. This vector expresses a eGFP-NT2 sgRNA with modified U6 promotor and sgRNA constant region.DepositorInsertBFP selectable marker, plus a modified mU6 promoter and sgRNA constant region for optimized CRISPRi activity
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX459-SpCas9-NG
Plasmid#171370PurposeSpCas9-NG-mediated genome editing.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6 for sgRNA; CBh for Cas9-2A-puroRAvailable sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide_GFP_NT135
Plasmid#183118PurposepLentiGuide modified to express GFP and a non-targeting sgRNADepositorInsertNT135
UseLentiviralTagsExpressionMutationPromoterU6Available sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_Puro_sgTP53
Plasmid#187819PurposepLentiCRISPR that is selectable with puromycin with an sgRNA targeting TP53DepositorInsertsgTP53
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide_mCherry_NT135
Plasmid#183121PurposepLentiGuide modified to express mCherry and a non-targeting sgRNADepositorInsertNT135
UseLentiviralTagsExpressionMutationPromoterU6Available sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only