-
Plasmid#199674PurposeTransient expression of LYCHOS (GPR155) F43I mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationF43 mutated to IPromoterCMVAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dMET
Plasmid#176031PurposeA knock-out vector for dog METDepositorInsertA gRNA targeting the dog MET gene and the cDNA of Cas9 (MET )
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-R/G-ICUE
Plasmid#181849PurposeICUE cAMP sensor using sfGFP and mRuby2 as the FRET donor and acceptor.DepositorInsertR/G-ICUE (RAPGEF3 Human)
UseTagsmRuby2 and sfGFPExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
SOD1_pcDNA6.2/EmGFP-Bsd
Plasmid#176964PurposeMammalian expression vector encoding SOD1 and EmGFP-BsdDepositorInsertSOD1 (SOD1 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorUseTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…PromoterAvailable sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorUseTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…PromoterAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
JDW 249 (pTol2-Dll4-F2-ETS#2-WT-8X-E1b-EGFP)
Plasmid#156417Purpose8X copies of the ETS#2 site of the murine Dll4 intronic enhancer and a minimal E1b reporter driving expression of EGFP flanked by Tol2 sitesDepositorInsertmurine Dll4 F2-6/F8 ETS site B/ site #2, 8X
UseZebrafish transgenesisTagsExpressionMutationPromoterE1b min pro/b-globin intronAvailable sinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA8-Flag-LARS (361-720aa)
Plasmid#139688PurposeExpresses N-teminal Flag tagged aa 361-720 of LARS1DepositorInsertLARS1 (LARS1 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-FRT-T0-RNF168 delta MIU1/MIU2
Plasmid#133980Purposeinducible mammalian expression vector of eGFP tagged RNF168 where both motifs interacting with ubiquitin have been deletedDepositorInsertRNF168 (RNF168 Human)
UseTagseGFPExpressionMammalianMutationdeletion of MIU1 and MIU2PromoterCMVAvailable sinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Cry2 mcherry Gamma 9 in pcDNA3.1
Plasmid#64208PurposemCherry fused between Cry2 and gamma 9 to study cell migrationDepositorUseTagsmcherry and n/aExpressionMammalianMutationPromoterCMVAvailable sinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-10-3xFLAG-LGP2-MIIa
Plasmid#58684PurposeExpresses LGP2 with a mutation to motif IIa in mammalian cellsDepositorInsertLGP2-MIIa (DHX58 Human)
UseTags3x FLAGExpressionMammalianMutationmutation to Motif IIA, K138E and Y142FPromoterCMVAvailable sinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST-mCherry-ARHGEF2
Plasmid#207959PurposeExpression vector for ARHGEF2 (GEF-H1) with an N-terminal mCherry tagDepositorInsertARHGEF2 (ARHGEF2 Human)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Jph3 WPRE
Plasmid#236238PurposeAAV expression of human Junctophilin3 N-terminally tagged with HaloTagDepositorInsertJunctophilin 3 (JPH3 Human)
UseAAVTagsHaloTagExpressionMutationPromoterhuman Synapsin 1Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
CMV Marina-T2A-nls-mCherry
Plasmid#74216Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertfluorescent protein voltage sensor
UseTagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterCMVAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
UseTagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-mFzd5
Plasmid#102867PurposeExpresses mouse Fzd5 in mammalian cellsDepositorInsertFrizzled 5 (Fzd5 Mouse)
UseLentiviralTagsExpressionMammalianMutationA to G substitution at nucleotide 699 of Fzd5 ORF…PromoterEF1AAvailable sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
HSPA8_pLX307
Plasmid#98343PurposeLentiviral expression of HSPA8DepositorInsertHSPA8 (HSPA8 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterE1FaAvailable sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
hSyn Marina-T2A-nls-mCherry
Plasmid#85843Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertGEVI Marina
UseTagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterhSyn1Available sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-pGC-A
Plasmid#186626PurposepFastBac1 (baculovirus polyhedrin promoter) encoding HA signal peptide, TEV-protease cleavable His10-tag, and full-length human pGC-A (NP_000897.3 amino acids 33-1061; expression-optimized DNA)DepositorInsertNPR1 (NPR1 Human)
UseTagshemagglutinin (HA) signal peptide + His10-tag + T…ExpressionInsectMutationdeleted amino acids 1-32PromoterpolyhedringAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-blast
Plasmid#167829PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 Flag MKK7B2Jnk1a1
Plasmid#19726DepositorUseTagsFlagExpressionMammalianMutationPromoterAvailable sinceMarch 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pFUSE-rIgG-Fc2-ICAM1
Plasmid#156462PurposeExpresses a rabbit Fc-ICAM1 fusion protein in mammalian cellsDepositorInsertIntercellular Adhesion Molecule 1 (Icam1 Mouse)
UseTagsICAM1-rFcExpressionBacterial and MammalianMutationendogenous signal peptide replaced with IL2 signa…PromoterhEF1-HTLCAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF2
Plasmid#141189PurposeExpresses GFP-GIGYF2 in mammalian cells, can be used to make inducible cell lineDepositorInsertGIGYF2 (GIGYF2 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-blast
Plasmid#167822PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5/G226A/A366S)
Plasmid#55797PurposeThis highly effective dominant negative G protein alpha-s mutant contains, in addition to the mutations in alpha-s(alpha3beta5/G226A), the A366S mutation, which increases GDP release.DepositorInsertalpha-s (alpha3beta5/G226A/A366S) (Gnas Rat)
UseTagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A, A366S i…PromoterCMVAvailable sinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MED12_pLX307
Plasmid#98350PurposeLentiviral expression of MED12DepositorInsertMED12 (MED12 Human)
UseLentiviralTagsV5ExpressionMammalianMutationR1392QPromoterE1FaAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
AIP(WT)-mChF-giantin
Plasmid#61523PurposeExpression of human golbin B1 and FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIPDepositorUseTagsAIP and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-PD-1ecto&tmd-BTLAicd-mGFP
Plasmid#180794PurposeExpression of human PD-1 extracellular domain and transmembrane domain fused to BTLA intracellular domain followed by mEGFPDepositorUseLentiviralTagsmEGFPExpressionMutationPromoterSFFVAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only