We narrowed to 9,861 results for: CAG
-
Plasmid#118705PurposeLentivirus for expression of shRNA1 against human HIF1a (Dox-inducible)DepositorInsertshRNA against human HIF1a
UseLentiviralAvailable sinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
miCBE
Plasmid#205413PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with APOBEC3A and UGI driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6__RNA*_pCAG_bpNLS_APOBEC3A(W104A)_XTEN_OgeuIscB*(D61A)_NLS_2xUGI_bGHployA_pCMV_mCherry
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable sinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC90-pmax-DEST
Plasmid#48222PurposeGateway Destination vector derived from Clontech's pmax (CAGGS) expression vectorDepositorTypeEmpty backboneUseCRISPR and Gateway CloningExpressionMammalianPromoterCAGGSAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
eMagA-mCherry-Mito
Plasmid#162251PurposeBlue-light dependent heterodimerization systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteMagA-mCherry-OMP25
ExpressionMammalianPromoterbeta-actin promoterAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUGW ORANGE Gria1-GFP KI _ mCherry-KASH
Plasmid#131507PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorUseLentiviralExpressionMammalianPromoterhUBCAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
APX1-H2B-mEos3.2
Plasmid#245522PurposePlasmid for PiggyBac /ITR mediated insertion of H2B-mEos sequence downstream of CAG promoter using Gateway recombination cassetteDepositorInsertH2B-mEos
ExpressionMammalianAvailable sinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
APX1-pm-eGFP
Plasmid#245520PurposePlasmid for PiggyBac /ITR mediated insertion of pm-eGFP downstream of CAG promoter using Gateway recombination cassetteDepositorInsertpm-eGFP
ExpressionMammalianAvailable sinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9GFP-shP53
Plasmid#102906PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-GFP. Includes p53 shRNA expression cassette.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pATM (pKD-G11)
Plasmid#62690PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP123/amiR-eGFP419/tdTomato
UseRNAiExpressionMammalianAvailable sinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pARC (pKD-G3)
Plasmid#62682PurposeMammalian expression of amiR-eGFP from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP123
UseRNAiExpressionMammalianAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATI (pKD-G7)
Plasmid#62686PurposeMammalian expression of amiR-eGFP from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP123/amiR-eGFP419
UseRNAiExpressionMammalianAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_gRNA_1
Plasmid#196625PurposeKnock-out STING in murine cells, gRNA 1.DepositorAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIS1-Eef25UTR-TOPmut-renilla
Plasmid#38236DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEef2_TOPm_5UTR/Renilla (Eef2 Mouse)
UseLuciferaseExpressionMammalianMutationThe first nucleotides of the 5' UTR were cha…PromoterEndogenous Eef2Available sinceNov. 7, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
HA-ISceID44A
Plasmid#59424PurposeExpresses a catalytically inactive form of the endonuclease ISceIDepositorInsertendonuclease ISceI mutant (I-SceI )
TagsHA tagExpressionMammalianMutationchanged aspartate 44 to alanine (D44A)Available sinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertsgRNA against AAVS1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCR-Hyg
Plasmid#158708PurposeFor cloning and constitutive expression of crRNAs in mycobacteriumDepositorInsertcrRNA
UseCRISPR and Synthetic Biology; Mycobacteria expres…ExpressionBacterialPromoterHsp60Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-EB3mCherry_cmv-LifeActGFP
Plasmid#133927PurposeLive dual labeling of the actin network and polymerizing microtubules for dynamic analysis of the cytoskeletonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEB3-mCherry and Lifeact-GFP (MAPRE3 Human)
ExpressionMammalianAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only