We narrowed to 13,817 results for: EGFP
-
Plasmid#89637PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG, 6*His, and T2A-EGFPExpressionMammalianMutationC141S, TGC-->TCC; S317A, AGC-->GCCPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro IRES-EGFP
Plasmid#14430DepositorHas ServiceCloning Grade DNAInsertIRES-EGFP
UseRetroviralExpressionMammalianAvailable SinceMarch 16, 2007AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_TNF-SBP-EGFP
Plasmid#65278Purposesynchronize trafficking of TNF from the ER (RUSH system)DepositorInsertTNF (TNF Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCALPS-Flag-Miwi-EGFP
Plasmid#212575PurposeLentiviral expression of Flag-tagged mouse Miwi in mammalian cellsDepositorInsertMiwi (Piwil1 Mouse)
UseLentiviralTags5x Flag and SNAP tagExpressionMammalianPromoterSFFVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-53BP1
Plasmid#60813Purposemammalian expression vectorDepositorAvailable SinceDec. 9, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCCL/IFNB1-d2eGFP-3’UTR
Plasmid#180232PurposeReporter plasmid utilizing d2eGFP as a reporter gene. Expression is designed to mimick IFNB1DepositorInsertd2eGFP
UseLentiviralPromoter1 kb upstream of IFNB1 CDSAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-Hygro
Plasmid#184593PurposeEGFPDepositorInsertEGFP
UseLentiviralPromoterCMVAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-3XFLAG-EGFP-OMP25
Plasmid#83354PurposeFor tagging mitochondria with Sigma FLAG epitopesDepositorInsert3XFLAG-EGFP-OMP25
UseRetroviralExpressionMammalianAvailable SinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRE/VEGF/IRES/EGFP
Plasmid#206211PurposeAn expression vector of VEGF and EGFP under control of TRE promoterDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Str-Golgin84_VSVG-SBP-EGFP
Plasmid#65305Purposesynchronize trafficking of Golgin-84 from the Golgi apparatus (RUSH system)DepositorInsertGolgin-84 (GOLGA5 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-EGFP-NLS
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1-Q61L
Plasmid#12981DepositorInsertRac1 constitutively active (RAC1 Human)
TagsEGFPExpressionMammalianMutationQ61L Constitutively activeAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pTH-iCre:EGFP-WPREpA
Plasmid#213142PurposeTruncated rat TH promoter expressing iCre fused to EGFPDepositorInsertiCre
UseAAVTagsEGFPExpressionMammalianPromoterTruncated TH promoter from rat (Rattus norvegicus…Available SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-eGFP-Kindlin 1
Plasmid#203733PurposeAAV vector plasmid expressing mouse kindlin-1 fused to eGFP under the human synapsin (SYN) promoterDepositorInsertFermt1 (Fermt1 Mouse)
UseAAVTagseGFPExpressionMammalianPromoterHuman synapsin promoterAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
LncRNA overexpression EF1α_BbsI_SV40 polyA_EGFP
Plasmid#219828PurposeOverexpression vector for non-coding RNAs driven by EF1α promoter with GFP. Cloning using BbsI.DepositorTypeEmpty backboneExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB-TetON-mEGFP-MYOD1_AroPERFECT
Plasmid#215620PurposeFor integration of MYOD1 AroPERFECT T2A mEGFPDepositorAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only