We narrowed to 535 results for: gcg.2
-
Plasmid#117321PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseLentiviralTagsGFP-PuroExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_PSMD1_sgRNA_1
Plasmid#155102Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_PSMD1_sgRNA_1
Plasmid#155107Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFOXF2.1.0-gDNA
Plasmid#113784PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXF2DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-createR194G-A9-gRNA_(CJT87)
Plasmid#226988PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-R194G cell line via adenine base editing (target base in position A9)DepositorInsertSpCas9 gRNA A9 to create OPA1-R194G
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB09-TRE-beta-globin-miR-124-EF1a-GFP
Plasmid#117318PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseTransposon-mediated integrationTagsGFPExpressionMammalianPromoterTet-inducible promoterAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2)
Plasmid#171099PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Ascl1.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g2
Plasmid#120210PurposeCENPB CRISPRi guide RNA 2DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RBM15B_WT_V5
Plasmid#83010PurposeGateway Donor vector containing RBM15B, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-ERCC1 gRNA2
Plasmid#211631PurposesgRNA-2 against ERCC1DepositorInsertsgRNA ERCC1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-VEGFA
Plasmid#140588PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA VEGFA
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-ALDH1A3
Plasmid#140589PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA ALDH1A3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-SYNPO
Plasmid#140587PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA SYNPO
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pLY103
Plasmid#130937PurposeEngineered sgRNA-LEA1 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA1
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY105
Plasmid#130939PurposeEngineered sgRNA-LEA3 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA3
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only