We narrowed to 11,953 results for: SOM
-
Plasmid#29439DepositorInsertINO80 (INO80 Human)
TagsFlagExpressionMammalianMutationINO80 267-1261 (a.a.) with Q1116K mutationAvailable SinceAug. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/FLAG-Ino80 ΔNC-EQ (267-1261)
Plasmid#29437DepositorAvailable SinceJuly 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A774L
Plasmid#174796PurposeBacterial expression of a hyperactive PARP1 mutant (A774L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-W318R
Plasmid#174793PurposeBacterial expression of an inactive PARP1 (W318R disrupts interdomain communication and HD subdomain unfolding)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
CHAF1B_pLENTI-CAG-IRES-GFP
Plasmid#177009PurposeMammalian lentiviral expression vector encoding CHAF1BDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A762V
Plasmid#174795PurposeBacterial expression of wild type PARP1 mutant (A762V is reversion of the common V762A polymorphism)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-Avi-Cerulean-Rpl10a
Plasmid#79880PurposeBeta-actin2 promoter driving Avi-tagged protein containing Cerulean protein fused to zebrafish Rpl10a ribosomal unit (Tryon et al. 2012); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to zebrafish Rpl10a ribosomal unit (rpl10a Zebrafish)
TagsAviExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/Flag-hINO80 HSA (212-526)
Plasmid#29443DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRRLsin.PPT.CMV‐GFP‐Eps8 WT
Plasmid#74922PurposeLentiviral plasmid expressing Eps8 fused to GFPDepositorAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR1
Plasmid#176244PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/Flag-hINO80C (1224-1556)
Plasmid#29445DepositorAvailable SinceAug. 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-WDR12-S127F
Plasmid#116707PurposeLentiviral expression of WDR12 S127FDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ROR1-T69M
Plasmid#116675PurposeLentiviral expression of ROR1 T69MDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154G/H250Y
Plasmid#108490Purposeexpression of vsv-AuroraB Analog sensitive (L154G/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsVSVExpressionMammalianMutationAnalog sensitive L154G/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II no force control (FL-based)
Plasmid#118724PurposeThe no force control for the FL-based human desmoplakin II tension sensor serves to detect changes in FRET between YPet(short) and mCherry that are tension-independent.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)-FL-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherryExpressionMammalianMutationtruncation after aa1353PromoterCMVAvailable SinceDec. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRL_LYSET_Y34X
Plasmid#246084PurposeStable expression of LYSET Y34X (isoform 2; Y72X in isoform 1)DepositorAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D1-86-SFB
Plasmid#247913PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D1-86DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 1-86Available SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-FL-SFB
Plasmid#247912PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-SFB-ZNF451
Plasmid#247909PurposeMammalian expression construct for N-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged ZNF451DepositorInsertZNF451 (ZNF451 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 CHIP delU-box-Myc
Plasmid#246738PurposeMammalian expression of human CHIP with U-box domain deleted, and a myc-tag on its C-terminusDepositorInsertCHIP (Carboxy terminus of Hsc70-interacting protein) (STUB1 Human)
TagsMycExpressionMammalianMutationdeletion of U-box domainPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL_LYSET
Plasmid#246082PurposeStable expression of LYSET (isoform 2)DepositorAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL_LYSET_R7W
Plasmid#246083PurposeStable expression of LYSET R7W (isoform 2; R45W in isoform 1)DepositorAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4K16Q-Halo-FRT
Plasmid#247458PurposeExpresses wild-type H4K16Q-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4K16R-Halo-FRT
Plasmid#247457PurposeExpresses wild-type H4K16R-Halo under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-EF1-H4-HaloTag-IRES-Neo
Plasmid#247450PurposeExpresses wild-type H4-Halo under EF1 promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4Δ1-19-HaloTag-FRT
Plasmid#247456PurposeExpresses wild-type H4(Δ1-19)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4Δ1-19 lacks the initial 19 residues at the N-te…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO391
Plasmid#235751PurposeProtein expression of ScVPS38, untagged + ScVPS34, untagged + FL ScVPS15-ZZ + ZZ-FL ScVPS30DepositorInsertsTags3xTEV-ZZ and ZZ-3xTEVExpressionYeastMutationS2A and T134A, I851RPromoterGALGAPDHAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL388
Plasmid#243717PurposeStably expresses a Myc-tagged AKAP1 with a GDDG mutation and gRNA-resistant silent mutationsDepositorInsertAKAP1 (AKAP1 Human)
UseLentiviralTagsMycMutationGXXG motif (GKQG 624-627) mutated to GDDG, and gR…Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJH061
Plasmid#243722PurposeExpresses a chimeric form of ALDH18A1, where the region between residue 97 and 351 is replaced by a 250-residue XTEN linkerDepositorInsertALDH18A1(1-97aa)-XTEN250-ALDH18A1(351aa-stop) (ALDH18A1 Human)
UseLentiviralMutationThe region between residue 97 and 351 of ALDH18A1…Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS02 NAPstar2
Plasmid#241272PurposeExpresses NADPH/NADP+ biosensor NAPstar2 in Arabidopsis thalianaDepositorInsertcyt-NAPstar2
ExpressionPlantAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS02 NAPstar7
Plasmid#241224PurposeExpresses NADPH/NADP+ biosensor NAPstar7 in Arabidopsis thalianaDepositorInsertcyt-NAPstar7
ExpressionPlantAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS02 NAPstar6
Plasmid#241223PurposeExpresses NADPH/NADP+ biosensor NAPstar6 in Arabidopsis thalianaDepositorInsertcyt-NAPstar6
ExpressionPlantAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS02 NAPstar4.3
Plasmid#241222PurposeExpresses NADPH/NADP+ biosensor NAPstar4.3 in Arabidopsis thalianaDepositorInsertcyt-NAPstar4.3
ExpressionPlantAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSS02 NAPstar1
Plasmid#241270PurposeExpresses NADPH/NADP+ biosensor NAPstar1 in Arabidopsis thalianaDepositorInsertcyt-NAPstar1
ExpressionPlantAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR5 Mm ATP10B
Plasmid#216391Purposetransfer plasmid for AAV vector production of mCherry and miR for Mm ATP10BDepositorInsertmcherry and miR Mm ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B
Plasmid#216392Purposetransfer plasmid for AAV vector production of mCherry and miR for rat Rn ATP10BDepositorInsertmcherry and miR Rn ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO1101
Plasmid#235708PurposeExpression of FL human Beclin 1 and FL human ATG14L in mammalian cellsDepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_msfGFP-HMGB1-Mut-11G3F3G
Plasmid#237626PurposeFor overexpression of msfGFP-HMGB1-Mut-11G3F3GDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_msfGFP-HMGB1-Shuffled 9
Plasmid#237657PurposeFor overexpression of msfGFP-HMGB1-Shuffled 9DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only