We narrowed to 34,448 results for: CaS;
-
Plasmid#183374PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-tiger-Caspase-1/4b
Plasmid#183372PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-panda-Caspase-1/4b
Plasmid#183371PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-dingo-Caspase-1/4b
Plasmid#183369PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-cheetah-Caspase-1/4b
Plasmid#183373PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-dog-Caspase-1/4b
Plasmid#183365PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b (CASP4 Canis lupus familiaris)
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-human-caspase-1/4b
Plasmid#183394PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of human caspase-1 fused to human caspase-4 (CASP1 Human, Synthetic)
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-dog-Caspase-1/4a
Plasmid#183363PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4a (CASP4 Canis lupus familiaris)
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-fox-Caspase-1/4b
Plasmid#183367PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycExpressionMutationPromoterMESVAvailable sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
UseTags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGPromoterAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only