We narrowed to 59,739 results for: Gene
-
Plasmid#72045PurposeExpresses the extracellular region of the Sema6D, isoform 5 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Sema3b(L)-AP-His
Plasmid#72013PurposeExpresses the Sema3B protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.d-AP-His
Plasmid#71987PurposeExpresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH671-SUP35-H348Q
Plasmid#29732DepositorInsertSUP35 gene encoding translation release factor 3 from S. cerevisiae (SUP35 Budding Yeast)
ExpressionYeastMutationH348Q mutant gene of SUP35 including genomic sequ…Available SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHPdesteGFP
Plasmid#24566DepositorInsert
UseReporter constructTagseGFPAvailable SinceMay 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-AP-His
Plasmid#72039PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(S)-AP-His
Plasmid#72040PurposeExpresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL2
Plasmid#39178PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SHP2(WT)@pLKO-Trex-SBP
Plasmid#85457PurposeGene expressionDepositorAvailable SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.0-mIghg1
Plasmid#127158PurposeExpression of secretory immunoglobulin heavy chains in mammalian cells, mouse (C57BL/6), IgG1 isotypeDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-hGTB
Plasmid#26196DepositorInsertTet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein
UseAAV and Cre/Lox; Adeno-associated virusMutationF2A has 2A cleavage site deleted, producing htTA-…Available SinceNov. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-Fc-His
Plasmid#72097PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-nuclear-EKAR4
Plasmid#174439PurposeNuclear-targeted EKAR4.DepositorInsertnuclear-EKAR4
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS:Zebrabow-B
Plasmid#118216PurposeFor broad gal4 inducible expression of Brainbow in zebrafishDepositorInsertBrainbow 1.0 L
UseZebrafish expressionAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-gamma-tubulin
Plasmid#87956PurposeExpresses human gamma-tubulin with a GFP-tag on the C-terminal of the proteinDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene …Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
p7SL-neo-TET
Plasmid#51285Purposeexpresses human 7SL RNA, using its own polIII enhancer, and tagged with the self splicing intron neo cassetteDepositorInsert7SL RNA (RN7SL2 Human)
TagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianPromoter7SL upstream pollII enhancerAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSEVA331Bb
Plasmid#78269PurposepSEVA331 with Biobrick multiple cloning siteDepositorTypeEmpty backboneAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCA-T-intron(Neo)-G(LNL)
Plasmid#36908DepositorInsertsT (i.e., ATG, start codon as a first exon)
GFP
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides before nucleotide 275 and ins…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGW-GOI-TurboID
Plasmid#209378PurposeGateway compatible plasmid for TurboID-based proximity labelling experiment in plantaDepositorTypeEmpty backboneExpressionPlantMutationTurboID gene sequence C249AAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EKAR4
Plasmid#174437PurposeImproved cyan/yellow FRET-based ERK kinase activity reporter.DepositorInsertEKAR4
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tagExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4max-NRCH
Plasmid#136920PurposeExpresses BE4max-NRCH in mammalian cellsDepositorInsertBE4max-NRCH
UseCRISPRExpressionMammalianMutationsee manuscriptPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATG-2460
Plasmid#108713PurposeEF1-CBR2opt-T2A-copGFP (construct used for lentiviral transduction)DepositorInsertCBR2opt-copGFP fusion
UseLentiviralTagsCBR2opt fused to copGFPMutationPromega used directed evolution to create CBR (Cl…Promoterelongation factor-1Available SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXN2KS-Dsup
Plasmid#90019PurposeTo establish stable line expressing Dsup in constitutive mannerDepositorInsertDsup
ExpressionMammalianPromoterCAGAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH2
Plasmid#84452Purposeshuttle plasmid for sarA P1-CFP expressionDepositorInsertCFP Cerulean
UseShuttle vector e.coli-s.aureus, expression of sgf…Available SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-Fc-His
Plasmid#72136PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-AP-His
Plasmid#72010PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del13)-AP-His
Plasmid#72011PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 13), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.1-mIglc2
Plasmid#127156PurposeExpression of immunoglobulin light chains in mammalian cells, mouse (C57BL/6), lambda 2 constant regionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only