We narrowed to 11,805 results for: NSI;
-
Plasmid#208657PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF0.5 in neuronsDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF0.5
UseAAVPromoterhSynAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Halo-tagged Sox17FNV
Plasmid#206391PurposeExpresses Halo-tagged mouse SOX17FNV in mammalian cells, for single-molecule tracking.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVTHM-mBrn2-3xflag
Plasmid#206390PurposeExpresses 3xflag fused mouse BRN2 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR R290H
Plasmid#203167PurposeYeast expression vector for hNUS1 R290HDepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2trLATm2allL+A
Plasmid#203750PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Residues within the transmembrane domain mutated to L and A to increase the TMD interfacial surface area with the membrane. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CHMP2A-myc, L216D/L219D
Plasmid#180645PurposeMammalian expression of CHMP2A with L216D/L219D mutations. Has C-terminal Myc tag. Internal ID:WISP20-13.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA528 KATNA1 MIT residues 1-79, V55D
Plasmid#180615PurposeBacterial expression for KATNA1 MIT domains, residues 1-79. Has V55D mutation. Has N-terminal HIS-SUMO tag. Internal ID: WISP20-23.DepositorInsertKATNA1 (KATNA1 Human)
TagsHIS-SUMOExpressionBacterialMutationResidues 1-79, V55D mutationPromoterT7Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-KATNA1 R14A
Plasmid#160052PurposeMammalian expression vector for KATNA1 (KATANIN-P60) R14A mutant with N-terminal One-Strep-Flag tag. Internal ID: WISP20-19.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-KATNA1 V55D
Plasmid#160053PurposeMammalian expression vector for KATNA1 (KATANIN-P60) V55D mutant with N-terminal One-Strep-Flag tag. Internal ID: WISP20-17.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_IRES-mCherry
Plasmid#197427PurposeHomology-directed repair template targeting IRES-based π-element to MAPRE1 exon 5DepositorInsertIRES-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-mCherry
Plasmid#197429PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-EGFP
Plasmid#197430PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsEGFP, GCN4 leucine zipper, LOV2, and Zdk1Available SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
hTln1-R1R2
Plasmid#191440PurposeExpresses the human TLN1 R1R2 domains in bacteriaDepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G_NT-GSDMD_I105N_NoCys
Plasmid#201177PurposeDox-inducible expression of NT-GSDMD gene in mammalian cells by retroviral transductionDepositorInsertGasdermin D N-terminal domain (Gsdmd Mouse)
UseRetroviralMutationaa1-276 only, I105N, C39A, C57A, C77A, C122A, C2…PromoterTRE3GAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G_NT-GSDMD_I105N_C192only
Plasmid#201178PurposeDox-inducible expression of NT-GSDMD gene in mammalian cells by retroviral transductionDepositorInsertGasdermin D N-terminal domain (Gsdmd Mouse)
UseRetroviralMutationaa1-276 only, I105N, C39A, C57A, C77A, C122A, C2…PromoterTRE3GAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G_NT-GSDMD_NoCys
Plasmid#201173PurposeDox-inducible expression of NT-GSDMD gene in mammalian cells by retroviral transductionDepositorInsertGasdermin D N-terminal domain (Gsdmd Mouse)
UseRetroviralMutationaa1-276 only, C39A, C57A, C77A, C122A, C265A, C19…PromoterTRE3GAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
H6GB1tev-IntC-P53(304-393)
Plasmid#200315Purposebacterial expression of P53 TETCTD for segmental labelingDepositorInsertp53 (304-393) (TP53 Human)
TagsHis6GB1tev and designed intein CExpressionBacterialPromoterT7Available SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
hPCNA-C148S
Plasmid#190939Purposeuntagged human PCNA with a cysteine to serine mutationDepositorInsertProliferating Cell Nuclear Antigen (PCNA Human)
ExpressionBacterialMutationchanged cysteine 148 to serinePromoterT7Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUGP1.1
Plasmid#196615PurposePlasmid used for the C-terminal tagging of Ugp1 with mCherry and the auxin-inducible degron in yeastDepositorInsertUGP1::mCherry-AID(71-114)-NatMX (UGP1 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES
Plasmid#182433PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20 (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertsVP2C-FPPS
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (M)
Plasmid#182435PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96W-N127W) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(M)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (G)
Plasmid#182477PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96C) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(G)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free NES (AG4TGGA)2
Plasmid#182488PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence (AG4TGGA)2 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free (PT)4P
Plasmid#182490PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence PTPTPTPTP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSmChnERT(#99)
Plasmid#184063Purposecyclofen-inducible mCherry nuclear relocation via mammalian cell transfection or mRNA synthesisDepositorInsertmCherry-nls-ERT2
UseSynthetic BiologyExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcA
Plasmid#184655PurposeRetroviral expression of mouse EPC1 delta EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationepc1 delta EPcAPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22iU66CriT(#387)
Plasmid#184061Purposecyclofen-inducible CRE activation in zebrafish permanent transgenicDepositorInsertCRE-ERT2
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag.Mm.Epc1-EPcA
Plasmid#184657PurposeRetroviral expression of mouse Epc1 EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1-EPcAPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.DMAP1
Plasmid#184651PurposeRetroviral expression of mouse Dmap1DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcC
Plasmid#184656PurposeRetroviral expression of mouse EPC1 delta EPcCDepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1 delta EPCc.QTPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only