We narrowed to 5,964 results for: crispr cas9 expression plasmids
-
Plasmid#186421PurposeExpression of dCas9 with C-terminal nanobody fusion recognizing spike protein from SARS-CoV-2DepositorInsertdCas9-scFv fusion (anti-SARS-CoV-2 spike)
UseCRISPRTags6HisExpressionMutationPromoterAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adra1b
Plasmid#184293PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adra1bDepositorInsertssgRNA-Adra1b
sgRNA-Adra1b
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSExpressionMutationPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_hROSA26_Left
Plasmid#191442PurposeExpresses the hROSA26 left sgRNA in combination with FLAGless eSpCas9(1.1) to target the hRosa26 safe harbor locusDepositorInserthROSA26 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-Cas9C
Plasmid#80932PurposeExpresses Cas9C in mammalian cells; derived from pZac2.1 with CASI promoter.DepositorInsertCas9C
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
SETD2(SET)-Cas9
Plasmid#186700PurposePlasmid encoding SETD2-Cas9 fusion under CMV promoterDepositorInsertSETD2(SET)-Cas9
UseCRISPRTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_puro
Plasmid#108100PurposeLentiviral expression plasmid of spCas9 with puromycin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS promoterAvailable sinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-NED
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianMutationPromoterCMVAvailable sinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9FL-P2A-turboGFP
Plasmid#80941PurposePlasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP.DepositorInsertCas9FL
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9C-P2A-turboGFP
Plasmid#80935PurposePlasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP.DepositorInsertCas9C
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available sinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHiFi Cas9-2×sgRNA (empty, donor)
Plasmid#162277PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.DepositorInsertHiFi Cas9
UseCRISPRTagsBPNLS and FLAG tagExpressionMammalianMutationSpCas9 (R691A)PromoterAvailable sinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-10xGCN4_Hygro
Plasmid#192651Purpose3rd generation lenti vector encoding dCas9-10xGCN4 (Suntag) with 2A Hygro resistance markerDepositorInsertdCas9-10xGCN4
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1195-pssAAV.U1a.hNme2Cas9
Plasmid#129534PurposeAAV vector expressing Nme2Cas9DepositorInserthuman codon-optimized Nme2Cas9
UseAAVTags2xNLS and NLS-3xHA-NLSExpressionMutationPromoterU1aAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cas9/pTREX-n
Plasmid#68708PurposeExpresses the fusion gene CAS9-HA-2xNLS-GFP in the pTREX-n backbone. This vector is used for cloning a specific sgRNA by BamHI, to be co-expressed with Cas9 for genome editing in Trypanosoma cruzi.DepositorInsertFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 (Addgene) .
UseCRISPRTagsFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 …ExpressionMutationC4239T mutation that eliminates a BamHI restricti…PromoterAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-NLS-SaCas9-NLS-3xHA-bGHpA-U6-BsaI-sgRNA
Plasmid#218710PurposeAAV vector plasmid expressing Cas9 from Staphylococcus aureus (SaCas9) under the human synapsin (SYN) promoter and its sgRNA under the U6 promoterDepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianMutationPromoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-dCas9_O
Plasmid#127028PurposeBasic Part O- ORF; Catalytically dead mutant of the Cas9 from Streptococcus pyogenes.DepositorInsertPart dCas9_O
UseSynthetic BiologyTagsExpressionBacterialMutationNonePromoterAvailable sinceJuly 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK Cas9-2A-Citrine
Plasmid#92393PurposeEnhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers.DepositorInsertCas9 2A Citrine
UseCRISPRTagsExpressionMammalianMutationPromoterthymidine kinase promoterAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only