We narrowed to 7,491 results for: RAP
-
Plasmid#127697PurposeDoxycyclin inducible shRNA knockdown of mouse STING geneDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE
Plasmid#73438PurposeProdeoxyviolacein pathway (vioABE) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variant G6.DepositorInsertPG6-vioABE
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgA1/λ
Plasmid#50370PurposeExpresses grass pollen allergen Phl p 7 specific human IgA1/λ antibody isotype (102.1F10-IgA1/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Alpha 1 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AmCyan
Plasmid#138481PurposeFor cloning sgRNA flanked by two ribozyme elements, to subsequently cloned into PL-5LTR-GW-A vector.DepositorInsertAmCyan
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC014_pLKO-U6-BsmBI-MS2sgRNA-EFS-Thy11-2A-MS2-p65-HSF1
Plasmid#192187PurposeTdgA vectorDepositorTypeEmpty backboneExpressionMammalianMutationNAAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-Trastuzumab-IgA2/κ
Plasmid#61889PurposeExpresses HER2/neu receptor specific humanized IgA2/κ antibody isotype (Trastuzumab-IgA2/κ)DepositorInsertsHER2/neu receptor specific humanized Alpha 2 heavy chain expression cassette
HER2/neu receptor specific humanized kappa light chain expression cassette
ExpressionMammalianPromotermEF1 Prom and rEF1 PromAvailable SinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-dV-IgE/λ
Plasmid#61879PurposeHuman immunoglobulin epsilon antibody expression vector (lambda light chain) without variable regions. Enables Colony-PCR screening of false-positive (PCR vector template) coloniesDepositorInsertsHuman immunoglobulin Epsilon constant region
Human immunoglobulin lambda constant region
ExpressionMammalianMutationDeleted Variable regionPromotermEF1 Prom and rEF1 PromAvailable SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GST-BcPC-PLC
Plasmid#224255PurposeExpress N-terminal HRV 3C protease cleavable GST fused to Bacillus cereus PC-PLC in E.coliDepositorTagsGST and HRV-3C (LEVLFQGP) siteExpressionBacterialMutationThe gene of Bacillus cereus ATCC 14579 was used f…Promoterlac promoterAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2NLS-Cas9
Plasmid#229773PurposeExpresses Cas9 driven by a CMV promoterDepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA2
Plasmid#220578PurposeTo inducibly knockdown CCND1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-KozATG-dL5-2XG4S-mCer3
Plasmid#73207PurposeExpresses dL5(E52D)-mCer3 fusion protein in cytosol of mammalian cells, penetrates nucleus. (MBIC5, dL5**, FAP)DepositorInsertKozATG-dL5-2XG4S-mCer3
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human USP7_H456A-3X FLAG
Plasmid#225335PurposeLentiviral expression of human mutant USP7 with 3x FLAG tag in mammalian cellsDepositorInsertUSP7 (USP7 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationH456APromoterEF1aAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-CRY2-CreN
Plasmid#26888PurposeExpresses N-terminal fragment of Cre fused to CRY2 for blue light-induced activation of DNA recombination when used with CIBN-CreC. Also expresses mCherry.DepositorExpressionMammalianMutationaa 19-104 of CrePromoterCMVAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLentiDP1.3
Plasmid#171096Purposelentiviral construct (3rd generation) for the expression of cell cycle-dependent OsTIR1 fused with mEmerald and Cdt1 (AKA ROLECCS G1) and miniAID-fused mCherry2DepositorInsertOsTIR1-mEmerald-Cdt1-P2A-miniAID-mCherry2
UseLentiviral and Synthetic BiologyTagsEmerald, cdt1, miniAID, mCherry2ExpressionMammalianPromoterCMVAvailable SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiDP1.2
Plasmid#171095Purposelentiviral construct (3rd generation) for the expression of cell cycle-dependent OsTIR1 fused with mEmerald and Geminin (AKA ROLECCS G2) and miniAID-fused mCherry2DepositorInsertOsTIR1-mEmerald-Geminin-P2A-miniAID-mCherry2
UseLentiviral and Synthetic BiologyTagsEmerald, Geminin, miniAID, mCherry2ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX304-MARK3
Plasmid#107235PurposeLentiviral gene expression vector for phospho-MARK3 expressionDepositorInsertMARK3
UseLentiviralExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B G120A
Plasmid#123115PurposeExpresses EGFP-LC3B G120A in mammalian cells. Negative control fluorescent reporter, unable to localize to autophagosomes.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFPExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgG4/λ
Plasmid#50369PurposeExpresses grass pollen allergen Phl p 7 specific human IgG4/λ antibody isotype (102.1F10-IgG4/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 4 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-YAP1 CA
Plasmid#79502PurposeMultiSite Gateway entry clones, second fragment (attL5, attL2) Human YAP1 S127A mutant CDSDepositorInsertYAP1 (YAP1 Human)
UseMultisite gateway entry cloneTags3XFLAGMutationS127APromoterno PromoterAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMC059-HisMS2_PLP_NucPhos_pac
Plasmid#155039PurposeGeneration of MS2 Virus Like Particles packaged with the sequence for the SARS-CoV-2 Nucleocapsid Phosphoprotein geneDepositorInsertsMaturation Protein
Coat Protein Dimer
Nucleocapsid Phosphoprotein
ExpressionBacterialMutationRemove TypeIIs Restriction SitesPromoterT7Available SinceSept. 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
Plasmid#209198PurposeMutagenesis of ThDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX62
Plasmid#46854PurposeTOP Hupki-puro2A-G245S plasmid to introduce mutant p53 to PLF ESC or MEFs by IMCEDepositorAvailable SinceAug. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pC129: pAAV.CMV-CasRx mCh
Plasmid#203442PurposePlasmid expressing active RfxCas13d with mCherry reporter for investigating CasRx activityDepositorInsertRfxCas13d-T2A-mCherry
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgA2/λ
Plasmid#50371PurposeExpresses grass pollen allergen Phl p 7 specific human IgA2/λ antibody isotype (102.1F10-IgA2/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Alpha 2 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX68
Plasmid#46857PurposeOP Hupki-puro2A-A138V plasmid to indroduce mutant p53 to PLF ESC or MEFs by IMCEDepositorAvailable SinceAug. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-EF1.Pro
Plasmid#79488PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human EF1 promoterDepositorInsertEF1 Promoter (EEF1A1 Human, Synthetic)
UseMultisite gateway entry clonePromoterEF1 PromoterAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-IL6.Pro
Plasmid#79491PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human IL6 promoterDepositorAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only