We narrowed to 8,624 results for: FIE
-
Plasmid#222891PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2127-FRB-GPA-114-20-CyOFP1
Plasmid#222886PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2129-FRB-GPA-114-5-CyOFP1
Plasmid#222888PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2128-FRB-GPA-114-10-CyOFP1
Plasmid#222887PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2131-FKBP-GPA-114-10-CyOFP1
Plasmid#222890PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2130-FKBP-GPA-114-20-CyOFP1
Plasmid#222889PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Amber-free HIV-1 deltaRT
Plasmid#213007PurposeAn replication-incompetent amber-free HIV-1 encodes full-length Env BG505 with RT-deleted Q23 as the backbone.DepositorInsertsHIV-1 Q23 ΔRT backbone (reverse transcriptase is deleted)
Env BG505
UseUnspecifiedAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST AO7RE ∆238-245
Plasmid#139318PurposeGST tagged AO7 encoding aa 126-258 with an internal deletion that results in loss of E2 binding for expression in bacteriaDepositorInsertAO7 aa 126-258 (RNF25 Human)
TagsGSTExpressionBacterialMutationAO7 cloned into the first multiple cloning site o…PromoterT7 promoter-1Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 HEK3 PegRNA
Plasmid#206277PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes HEK3 PegRNADepositorInsertHEK3 PegRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
YW347_Ptbb2UTR-loxP-RFP-miniMOS
Plasmid#196064Purposea plasmid modified from miniMOS vector pCFJ910. the modification including insertions of myo2p::TagRFP downstream to NeoR CDS and 2 loxP sites flanking the NeoR and tagRFP cassettes.DepositorInsertsmyo2p driven tagRFP
NeoR
Minimal Mos1
ExpressionWormPromotermyo-2Available SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_PM
Plasmid#182813PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_cyto
Plasmid#182814PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_cyto
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iFluoxSnFR_ER
Plasmid#182815PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_ER
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iFluoxSnFR_PM
Plasmid#182816PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_PM
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iFluoxSnFR_cyto
Plasmid#182817PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiFluoxSnFR_cyto
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV(MinDis)-iEscSnFR_ER
Plasmid#182812PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_ER
ExpressionMammalianPromoterhCMVAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEThT-RvCAHS8
Plasmid#192467PurposeBacterial expression of RvCAHS8DepositorInsertCAHS8
TagsHis6ExpressionBacterialPromoterT7Available SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEThT-RvCAHS3
Plasmid#192466PurposeBacterial expression of RvCAHS3DepositorInsertCAHS3
TagsHis6ExpressionBacterialPromoterT7Available SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22gCfpUbiG4FER4P2A(#249)
Plasmid#184070Purposecyclofen-inducible GAL4 activation in zebrafish permanent transgenicDepositorInsertGal4bdFF-ERT2-P2A
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8322 pDONR ATG-YAP1 S94A-Stop
Plasmid#184526PurposeSubcloning YAP1 S94ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8321 pDONR ATG-YAP1 S127A-Stop
Plasmid#184525PurposeSubcloning YAP1 S127ADepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Dendra-Rab11a
Plasmid#184038PurposeExpresses red to green photoconvertible Rab11aDepositorAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Cd155 shRNA2
Plasmid#166488PurposeMouse Cd155 RNAiDepositorInsertshRNA for mouse Cd155 (Pvr Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Cd155 shRNA1
Plasmid#166487PurposeMouse Cd155 RNAiDepositorInsertshRNA for mouse Cd155 (Pvr Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTTH+mEGFP-H1.4ΔCTD
Plasmid#157800PurposeExpression of mEGFP fused to human linker histone H1.4 without c-terminal tailDepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMTTH+LANA-H1.4CTD
Plasmid#157798PurposeExpression of LANA peptide-human linker histone H1.4 CTD fusion proteinDepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B-465-552
Plasmid#136029PurposeEIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-Delta-Hairpin
Plasmid#136030PurposeEIF3B (465-552) 3'UTR with the main hairpin deleted inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-1st-Hairpin
Plasmid#136031PurposeEIF3B (465-552) 3'UTR with only the main hairpin inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-Disrupted-Hairpin
Plasmid#136032PurposeEIF3B (465-552) 3'UTR with the main hairpin mutated inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-Restored-Hairpin
Plasmid#136033PurposeEIF3B (465-552) 3'UTR with the main hairpin restored inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-88nt-A:U-Hairpin
Plasmid#136034PurposeEIF3B (465-552) 3'UTR with the main hairpin mutated to A and U nucleotides only inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552-Unstructured
Plasmid#136028PurposeEIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTone-gata2aECE-nsGFP
Plasmid#132975Purposegata2a endothelial enhancer (x6) and basal promoter driving nuclear-localized sfGFP in pTol1 backboneDepositorInsertsnuclear localized sfGFP
gata2a endothelial enhancer (x6) with a carp b-actin basal promoter
UseUnspecified; Transposon-mediatedTags6x myc and SV40 NLSAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB153 - pL2_pSB90_2x35S::ZCT1::tMAS
Plasmid#123195Purposebinary plant vector for transient expression of ZCT1 from Catharanthus roseusDepositorInsert2x35S::ZCT1::tMAS
ExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB160 - pL2_pSB90_2x35S::ORCA3::tMAS
Plasmid#123196Purposebinary plant vector for transient expression of ORCA3 from Catharanthus roseusDepositorInsert2x35S::ORCA3::tMAS
ExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB166 - pL2_pSB90_tMAS::rLUC-I::pMAS
Plasmid#123199Purposebinary plant vector for transient expression of a Renilla luciferase (rLUC, with intron)DepositorInserttMAS::rLUC-I::pMAS
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
PCRII apoBb.1
Plasmid#121898PurposePlasmid for making zebrafish apoBb.1 in situ probeDepositorInsertApoBb.1 (apobb.1 Zebrafish)
UseUnspecifiedAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PCRII apoA-IVb.1
Plasmid#121903PurposePlasmid for making zebrafish apoA-IVb.1 in situ probeDepositorInsertApoa4b.1 (apoa4b.1 Zebrafish)
UseUnspecifiedAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only