We narrowed to 29,111 results for: PLE;
-
Plasmid#128012PurposeVector containing the lambdaN-entry expression cassette and a separate expression cassette driving mCherry via the traffic jam enhancerDepositorInsertLN-3xFlag
UseLamdan entry vectorTagsLN-3xFlagExpressionMutationPromoterAvailable sinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
FKBP-YPet-RanGAP*
Plasmid#175245PurposeBacterial expression and purification, SUMOylation substrate that can be recruited to FRB with rapamycin, Ypet is a FRET acceptor for CyPetDepositorInsertRANGAP1 (RANGAP1 Human)
UseTagsExpressionBacterialMutationAmino acid 562 F to APromotertacAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJN601
Plasmid#59790Purposezf1::yfp fusion with floxed unc-119(+) within an intron of yfp. For creating zf1::yfp knock-ins using unc-119 as a markerDepositorInsertsZF1 domain from pie-1
N-terminal half of yfp with introns
intron containing floxed unc-119 gene in reverse orientation
C-terminal half of yfp with introns
UseTagsExpressionWormMutationPromoterAvailable sinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pXW117As(RS-E11)
Plasmid#123145PurposeArsenic sensor with two-layered amplifier cascade. pSB4A3 carrying J117-30arsR-t-ParsR-30hrpR-30hrpS-t-PhrpLE-31ECF11(ASV)-t-Pecf11-30gfp-tDepositorInsertJ117-30arsR-t-ParsR-30hrpR-30hrpS-t-PhrpLE-31ECF11(ASV)-t-Pecf11-30gfp-t
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterJ117, ParsR, PhrpLE, Pecf11Available sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPuroR-MCS-GAL4-MiniWhite
Plasmid#165890PurposePuromycin resistant GAL4 driver vector with Mini-w+ CDS eye marker. Enhancer grammar GB20 entry point for custom enhancers. Cut-and-paste cloning can be used. Purple-white bacteria colony screening.DepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus-G protein Gamma 5
Plasmid#42200DepositorInsertGamma 5 (Gng5 Rat)
UseTagsVenus(1-155)ExpressionMammalianMutationcodon-optimizedPromoterCMVAvailable sinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSR06
Plasmid#69152Purposeread-outloxN mCherry to GFP switch for integration on ttTi5605, Mos Chr IIDepositorInsertsmCherry
eGFP
UseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0 and codon-optimzed index…Promoterrps-27Available sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
8200 Bicistronic_GFP_ires_hygro
Plasmid#64375PurposeThis a retroviral expression plasmid expressing GFP along with hygro resistance geneDepositorInsertEGFP
UseRetroviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralTagsExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Arp3_pLib
Plasmid#173677PurposeArp3 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expressionDepositorInsertArp3 (ACTR3 Human)
UseTagsExpressionInsectMutationPromoterpolyhedrinAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE(K294A) NLS-Flag
Plasmid#82469PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzyme, inactive formDepositorInsertmRNA capping enzyme (Rngtt Mouse)
UseTagsFlag and MycExpressionMammalianMutationchanged Lysine 294 to AlaninePromoterCMVAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE NLS-Flag
Plasmid#82468PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzymeDepositorInsertMyc-NES-mCE-Flag (Rngtt Mouse, HIV)
UseTagsFlag and MycExpressionMammalianMutationPromoterCMVAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPK-351
Plasmid#157921PurposepcDNA-CMV-PIF3MTAD-IRES-PhyBGal4DBDDepositorInsertsPIF3-MTAD
IRES
PhyB(1-621)-SV40NLS-Gal4DBD
UseSynthetic Biology; OptogeneticsTagsHA tag and SV40NLSExpressionMammalianMutationpif3 1-523PromoterCMVAvailable sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorInsertNES mRNA capping enzyme (Rngtt Mouse, HIV)
UseTagsmycExpressionMammalianMutationK294APromoterCMVAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-myc- mCE(Del 25C)
Plasmid#82472PurposeExpresses myc tag and mRNA capping enzyme without 25 amino acid from C-terminalDepositorInsertmyc-mCE-C terminal deleted (Rngtt Mouse)
UseTagsmycExpressionMammalianMutationPromoterCMVAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMflPT-o4
Plasmid#101315PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and pac resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
pac resistance gene
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMflST-o4
Plasmid#101316PurposeContains: complete oriC region of M. florum L1 (oriC4 fragment), colE1 rep origin, recoded tetM and aadA1 resistance genes, origin of transfer of RP4 plasmid.DepositorInsertsoriC4 of M. florum strain L1 (rpmH/dnaA and dnaA/dnaN intergenic regions, with dnaA)
aadA1 resistance gene
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSR04
Plasmid#69151Purposeread-outloxP mCherry to GFP switch, with eft-1::tagBFP::tbb-2UTR as gene of interest for integration on cxtTi10816, Mos Chr IVDepositorInsertsmCherry
TagBFP
eGFP
UseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0Promotereef-1A.1 (eft-3) and rps-27Available sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYO979
Plasmid#235756PurposeProtein expression of ScVPS38, untagged + ScVPS30 FRK to DDD at 430-432, untaggedDepositorUseTagsExpressionYeastMutationFRK430-432DDDPromoterAvailable sinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TDH3pro-rtTA-tetO7pro-T7pol-pRS413
Plasmid#239293PurposeExpresses the reverse tetracycline activator (rtTA) and T7 polymerase; Plasmid #1 of the tet-on overexpression systemDepositorInsertsT7 polymerase with NLS and P278L
reverse tetracycline transactivator (rtTA)
UseTagsExpressionYeastMutationContains M2-SE-G72P mutations, described in Addge…PromoterTDH3 and tetracycline-responsive element (TRE) an…Available sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only