We narrowed to 28,754 results for: sta
-
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SF3B3
Plasmid#156003PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1D
Plasmid#196686PurposeRep/Cap plasmid for the production of PAL1D, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTFR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.1
Plasmid#196687PurposeRep/Cap plasmid for the production of M.Fas.1, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationTDALTTK insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1B
Plasmid#196684PurposeRep/Cap plasmid for the production of PAL1B, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPSQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1A
Plasmid#196683PurposeRep/Cap plasmid for the production of PAL1A, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.4
Plasmid#196690PurposeRep/Cap plasmid for the production of M.Fas.4, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationVVSDYTV insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.3
Plasmid#196689PurposeRep/Cap plasmid for the production of M.Fas.3, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRVDPSGL insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Fas.2
Plasmid#196688PurposeRep/Cap plasmid for the production of M.Fas.2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationSTIPTMK insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP792_L2_FRT-OCS-tGFP_Red_mCherry_HSP-FlpO
Plasmid#192382PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when heat shocked.DepositorInsertAct2::B3RT-OCS-B3RT::Act2::FRT-OCS-FRT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP793_L2_V05_s35S_AND_GFP_pOp6_Flp_CO2_B3
Plasmid#192397PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when its AND gate unit is activated by both cell type (cortex) and chemical induction (by DEX).DepositorInsert35S::FRT-OCS-FRT::B3RT-OCS-B3RT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-npas4l
Plasmid#164654Purposefor the synthesis of zebrafish npas4l mRNADepositorInsertnpas4l (npas4l Zebrafish)
UseMrna synthesisMutationPlease see depositor commentsPromoterSP6Available SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-etsrp
Plasmid#164655Purposefor the synthesis of zebrafish etsrp mRNADepositorInsertetsrp (etsrp Zebrafish)
UseMrna synthesisAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-llo190-mc38minor
Plasmid#174604Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes Aatf, irgq and cpne1DepositorInsertpalmitoyl-GFP C-term fusion LLO190 and minigenes of 3 neoantigens from MC38 tumor in genes Aatf irgq cpne1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTF101.1gw3
Plasmid#172181PurposeA binary plasmid for gateway 3-Entry in pTF101.1 background (attR1 & attR2) containing double CaMV 35S promoter and TEV enhancer to drive bialophos resistance gene (bar) for plant transformation.DepositorInsertattR3-CmR-ccdB-attR4
ExpressionPlantPromoterlacUV5 promoterAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Flag-stm2585_Y167F
Plasmid#174398PurposeNative S. Typhimurium gene stm2585 (sarA/steE) with N-terminal GFP and Flag tags and its STAT3-binding YxxQ motif mutated to FxxQDepositorInsertsarA
TagsEGFP and FlagExpressionMammalianMutationY167FAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-stm2585_Y167F
Plasmid#174392PurposeS. Typhimurium gene stm2585 (sarA/steE) codon-optimized for mammalian expression with STAT3-binding YxxQ motif mutated to FxxQDepositorInsertstm2585
TagsFlagExpressionMammalianMutationTyr 167 changed to PheAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only