We narrowed to 11,344 results for: cat.1
-
Plasmid#159917PurposeMutagenesis of Drd1DepositorInsertDrd1 (Drd1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgReg1-2)-PGKpuro2ABFP-W
Plasmid#252912PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLexM-HsPQLC1(24-271)-FLAG
Plasmid#250418PurposeExpression of C-terminally FLAG-Tagged, N-Terminally Truncated (?1-23) HsPQLC1 in Mammalian CellsDepositorInsertPQLC1 (SLC66A2 Human)
TagsFLAGExpressionMammalianMutationΔ1-23 (new Start codon added)PromoterChicken-beta-actin promoter/CMV EnhancerAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLexM-HsPQLC1(16-271)-FLAG
Plasmid#250416PurposeExpression of C-terminally FLAG-Tagged, N-Terminally Truncated (?1-15) HsPQLC1 in Mammalian CellsDepositorInsertPQLC1 (SLC66A2 Human)
TagsFLAGExpressionMammalianMutationΔ1-15 (new Start codon added)PromoterChicken-beta-actin promoter/CMV EnhancerAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLexM-HsPQLC1(20-271)-FLAG
Plasmid#250417PurposeExpression of C-terminally FLAG-Tagged, N-Terminally Truncated (?1-19) HsPQLC1 in Mammalian CellsDepositorInsertPQLC1 (SLC66A2 Human)
TagsFLAGExpressionMammalianMutationΔ1-19 (new Start codon added)PromoterChicken-beta-actin promoter/CMV EnhancerAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
huCof WT + rat cof shRNA
Plasmid#245961PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of WT human cofilinDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianPromoterNeuronal Specific Enolase (NSE) for cofilin and p…Available SinceOct. 22, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
Plasmid#154473PurposeExpresses dCas9 fused to mCherry and the KRAB domain of ZIM3DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-OGT_opt
Plasmid#190858PurposeFor mammalian expression of wild-type full-length human ncOGT. The ncOGT is not epitope-tagged, but is codon-optimized for human cells.DepositorInsertO-GlcNAc Transferase (OGT Human)
ExpressionMammalianMutationCodon optimized for expression in human cells.PromoterCMVAvailable SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKI_ΩBBMVP16&WUS
Plasmid#220348PurposeExpresses BBM-VP16 and WUS in plant cellsDepositorTagsVP16 transcriptional activation domainExpressionPlantPromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDF-His-mTET1CD
Plasmid#81053Purposebacterial expression of the catalytic domain of murine TET1DepositorInsertTET1 (Tet1 Mouse)
Tags6HISExpressionBacterialMutationcatalytic domain amino acid 1367-2057PromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.Y591X) 3x FLAG
Plasmid#74261PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.Y591X truncationPromoterCMVAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-XL4 ASXL1 (p.R404X) 3x FLAG
Plasmid#74263PurposeCancer-associated ASXL1 truncation mutant in mammalian expression vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationp.R404X truncationPromoterCMVAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
EGFP_EHMT1_N300
Plasmid#228814PurposeExpression of human EHMT1 N-terminal 300 aa onlyDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 DomI + DomII pMT2
Plasmid#206095Purposeexpression of the N-terminus, Domain I, Domain II and the II-III loop (amino acids 1-1154) of rabbit Cav2.2 calcium channel with a N-terminal GFP tagDepositorAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PTEN-3'UTR
Plasmid#97204PurposeExpresses PTEN 3'UTR in mammalian cellsDepositorAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C
Plasmid#113008PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila TralDepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
NSE-huCof K22Q + rat cof shRNA
Plasmid#245962PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of K22Q mutant of human cofilinDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationK22QPromoterNSE for cofilin K22Q and pol III for shRNAAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MCP-huCof K22Q + rat cof shRNA
Plasmid#245959PurposeSilencing of endogenous cofilin in rat/mouse cells with replacement by human cofilin K22Q expressed with a cofilin promoterDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationK22QPromoterMCP for cofilin and pol III for shRNAAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pISL1.1.0-gDNA
Plasmid#113788PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ISL1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-sumo-h-cGASCD(K427E/K428E)
Plasmid#127162Purposeexpression of truncated human cGAS proteinDepositorAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PRKAA1
Plasmid#20595DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTR-341 pUC19-tNGFR-P2A-PDCD1 N
Plasmid#186074PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
hGli3 NTOTAL in AINGpCAGGS
Plasmid#121973Purposemedium Gli3 transcriptional repressorDepositorInserthGli3 NTOTAL (GLI3 Human)
UseChick electroporationTags5xmyc and Linker A IRES NLS GFP pCAGGSExpressionMammalianMutationC terminus deletion from zinc finger domainAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pitrm1_L (OZ515)
Plasmid#27190DepositorInsertZinc finger array targeting pitrm1 (pitrm1 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
vipr1_L (OZ559)
Plasmid#28084DepositorInsertZinc finger array targeting vipr1 (LOC100334247 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
vipr1_R (OZ560)
Plasmid#28085DepositorInsertZinc finger array targeting vipr1 (LOC100334247 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
fam82a2_L (OZ573)
Plasmid#35213DepositorInsertZinc finger array targeting fam82a2 (rmdn3 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
fam82a2_R (OZ574)
Plasmid#35214DepositorInsertZinc finger array targeting fam82a2 (rmdn3 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pitrm1_R (OZ516)
Plasmid#27191DepositorInsertZinc finger array targeting pitrm1 (pitrm1 Zebrafish)
UseZebrafish targetingAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-DN-14-3-3 zeta (R56A/R60A)
Plasmid#116889PurposeExpresses HA-tagged human dominant-negative 14-3-3 zeta (R56A/R60A) in mammalian cellsDepositorAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
NFATc1_L (OZ543)
Plasmid#28068DepositorInsertZinc finger array targeting NFATc1 (nfatc1 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
NFATc1_R (OZ544)
Plasmid#28069DepositorInsertZinc finger array targeting NFATc1 (nfatc1 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
LacZ in pLX304
Plasmid#42560DepositorInsertLacZ
UseLentiviralTags2xV5PromoterCMVAvailable SinceMarch 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
p6599 MSCV-IP N-HAonly FOSL1
Plasmid#34897DepositorAvailable SinceFeb. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL3-OT (wt TCF-4 sites)
Plasmid#16558DepositorInsertTCF-4 binding sites (TCF4 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutation3 copies of wildtype Tcf-4 binding sitesAvailable SinceMarch 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGL3-OF (mutant TCF-4 sites)
Plasmid#16559DepositorInsertTCF-4 binding sites (TCF4 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutation3 copies of mutant Tcf-4 binding sitesAvailable SinceMarch 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
pet23a_RBPMS_1_101
Plasmid#65728Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-101PromoterT7Available SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet28a_RBPMS_1_129
Plasmid#65738Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-129PromoterT7Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet28a_RBPMS_1_100
Plasmid#65735Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-100PromoterT7Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet23a_RBPMS_1_120
Plasmid#65730Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-120PromoterT7Available SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N+C-term K-R
Plasmid#233093PurposeExpression of GST-YihI with N+C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with N+C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with N+C-term lysines (K) mutated to arg…Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-All K-R
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEMHE:hTRAAK(Q258K)
Plasmid#224763PurposeIn vitro transcription for Oocyte expression of hTRAAK(Q258K)DepositorInsertPotassium channel subfamily member 4 (KCNK4 Human)
UseIn vitro transcription for oocyte expressionMutationQ258KPromoterT7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:hTRAAK(S118C)
Plasmid#224762PurposeIn vitro transcription for Oocyte expression of hTRAAK(S118C)DepositorInsertPotassium channel subfamily member 4 (KCNK4 Human)
UseIn vitro transcription for oocyte expressionMutationS118CPromoterT7Available SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ZGLP1
Plasmid#222926PurposePiggyBac transposon plasmid for doxycycline inducible expression of ZGLP1DepositorInsertZGLP1 (ZGLP1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FRISZ-GPI
Plasmid#177264PurposeAAV transfer plasmid for cell-surface-localized FRISZ (via CD59 GPI) under hSyn promoterDepositorInsertCD59 leader-FRISZ-GPI
UseAAVTagsCD59 GPI and CD59 leader sequencePromoterhSynAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pet28a_RBPMS_1_120
Plasmid#65737Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-120PromoterT7Available SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pet28a_RBPMS_1_144
Plasmid#65739Purposeplasmid for bacterial overexpression of RBPMSDepositorInsertRBPMS (RBPMS Human)
TagsHis TagExpressionBacterialMutationdeletion construct encoding amino acids 1-144PromoterT7Available SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only