We narrowed to 17,262 results for: POR
-
-
pL0M-S-mNeonGreen-EC18153
Plasmid#137075PurposeGolden Gate Level 0 S module for N-terminal fluorescent protein taggingDepositorInsertmNeonGreen DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-2mCh-PS
Plasmid#112268PurposeIDOCKS Acceptor ConstructDepositorInserttwo copies of mCherry followed by a pseudosubstrate peptide for PKC
TagsmChExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_Conc3
Plasmid#134450PurposeEmpty concatemer vector in which 3 sgRNAs can be inserted; with Cas9 + GFPDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD559 ZF173x6-Compact_EYFP
Plasmid#138873PurposeEYFP reporter vector for the ZF173x6-Compact promoterDepositorInsertZF173x6-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF173x6-CompactAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRATIO4212
Plasmid#141313PurposeGateway cloning compatible dual fluorescent ratiometric binary vectorDepositorTypeEmpty backboneTagsmScarlet-I and mVenusExpressionPlantPromoterUBQ10 promoterAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pECFP-IETD2x-Venus
Plasmid#24536DepositorInsertECFP-IETD2x-Venus
TagsECFP and VenusExpressionMammalianPromoterCMVAvailable SinceJune 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
pPD128 AND Gate, 3 repeats
Plasmid#138937PurposeEYFP reporter vector for the Logic 37 AND 158 NOT 43 3 repeats promoterDepositorInsertLogic 37 AND 158 NOT 43 3 repeats
UseSynthetic BiologyExpressionMammalianPromoterLogic 37 AND 158 NOT 43 3 repeatsAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSYC-97
Plasmid#31565DepositorInsertpCS4+-NLS-EGFP-P2A-mCherry-CAAX
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPD937 ZF37x12-Compact_EYFP
Plasmid#138932PurposeEYFP reporter vector for the ZF37x12-Compact promoterDepositorInsertZF37x12-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF37x12-CompactAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
px459V2.0_Conc3
Plasmid#134458PurposeEmpty concatemer vector in which 3 sgRNAs can be inserted; with Cas9 + PuroDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCHW110031
Plasmid#222437PurposeLevel 0, promoter module (GGAG-CCAT) containing CBS4 and CMV1 promoters.DepositorInsertCBS4-CMV1, , CBS4 promoter + CMV1 (Cucumber mosaic virus)
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD296 ZF43x12-Compact_EYFP
Plasmid#138907PurposeEYFP reporter vector for the ZF43x12-Compact promoterDepositorInsertZF43x12-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x12-CompactAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD290 ZF43x6-Compact_EYFP
Plasmid#138901PurposeEYFP reporter vector for the ZF43x6-Compact promoterDepositorInsertZF43x6-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-CompactAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGWB701NL3F10H
Plasmid#141288PurposeNo promoter, C-terminal NLUC:3xFlag:10xHis tag, attR1-Cmr-ccdB-attR2-NLUC:3xFlag:3xHis-TNOS (modified pGWB401, pPZP backbone, SpcR for bacteria, Tunicamycin R for plant)DepositorTypeEmpty backboneUseLuciferase; GatewayTagsFLAG (x3), HIS (x10), and NLUCExpressionPlantAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL358
Plasmid#169147PurposeEncodes OptoQ-AMP1DepositorInsertVP16-EL222
TagsSV40 NLSExpressionYeastAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-cdc2 (716)
Plasmid#61840Purposemammalian expression of cdc2DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCHERRY10
Plasmid#24664DepositorInsertmCherry
ExpressionBacterialAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBEL1994
Plasmid#139898PurposeExpression plasmid for LetB PLL2 deletion (without TM region)DepositorInsertLetB
ExpressionBacterialMutationLetB(43-877; delta229-239, D228G, L240G)-6xHisAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only