We narrowed to 38,427 results for: ANT
-
Plasmid#171751PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-E484K variantDepositorInsertSpike (S-GSAS-D614G-E484K variant) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-K417N
Plasmid#171752PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-K417N variantDepositorInsertSpike (S-GSAS-D614G-K417N variant) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-I692V
Plasmid#171746PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-I692V variantDepositorInsertSpike (S-GSAS-D614G-I692V variant) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-Y453F
Plasmid#171745PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-Y453F variantDepositorInsertSpike (S-GSAS-D614G-Y453F variant) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E2 (GB2239)
Plasmid#160561PurposetRNA and scaffold for the assembly of GBoligomers for position [2-3] of a polycistronic tRNA-gRNADepositorInserttRNA-gRNA position E2 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_M-Open-DDD
Plasmid#234561PurposeCTNNA1 M2-M3 salt-bridge disrupting mutantDepositorInsertmEGFP:hCTNNA1_M-Open-DDD (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationD392A, D500A, D503APromoterCMVAvailable sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_M-Open-KRR
Plasmid#234562PurposeCTNNA1 M2-M3 salt-bridge disrupting mutantDepositorInsertmEGFP:hCTNNA1_M-Open-KRR (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationK525A, R548A, R551APromoterCMVAvailable sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
A24M04 mIgM heavy chain-pFEEKW
Plasmid#234809PurposeExpress membrane form of IgM heavy chain containing the VH region of the monoclonal antibody, A24M04, specific for human papilloma virus16 L1DepositorInsertA24M04 membrane IgM heavy chain (IGHM Human)
UseLentiviralTagsExpressionBacterial and MammalianMutationPromoterEEK promoterAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
A24M04 Ig kappa light chain-pFEEKW
Plasmid#234810PurposeExpress Ig kappa light chain containing the VL region of the monoclonal antibody, A24M04, specific for human papilloma virus16 L1DepositorUseLentiviralTagsExpressionBacterial and MammalianMutationPromoterEEK promoterAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-deltaPEST
Plasmid#221118PurposeFAP tagged STE3-PEST mutant (delta413-470 - N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-deltaPEST
UseTagsExpressionYeastMutationSTE3 mutant that lacks the PEST domain in the C-t…PromoterSTE3Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMVP-SEC24C-G220C
Plasmid#231560PurposepMVP expression vector for human SEC24C (G220C mutation, closed, resistant to sgSEC24C #1 and #2) (Blasticidin selection marker)DepositorInsertSEC24C (G220C) (SEC24C Human)
UseLentiviralTagsV5ExpressionMammalianMutationG220C, silent PAM mutations (G67 (GGG>GGA) and…PromoterCMVAvailable sinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMVP-SEC24C-S107F
Plasmid#231561PurposepMVP expression vector for human SEC24C (S107F mutation, closesd, resistant to sgSEC24C #1 and #2) (Blasticidin selection marker)DepositorInsertSEC24C (S107F) (SEC24C Human)
UseLentiviralTagsV5ExpressionMammalianMutationS107F, silent PAM mutations (G67 (GGG>GGA) and…PromoterCMVAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Blast FAP S624A
Plasmid#207402PurposeExpresses the S624A mutant of FAP (Fibroblast Activation Protein), which shows no protease activity.DepositorInsertFibroblast Activation Protein Alpha (FAP Human)
UseRetroviralTagsExpressionMutationchanged Serine 624 to Alanine. It's a protea…PromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Blast FAP A657S
Plasmid#207403PurposeExpresses the A657S mutant of FAP (Fibroblast Activation Protein), which shows partial protease activity.DepositorInsertFibroblast Activation Protein Alpha (FAP Human)
UseRetroviralTagsExpressionMutationchanged Alanine 657 to Serine. It's an endop…PromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-F97W
Plasmid#203572PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Phenylalanine 97 to Tryptophan for partia…PromoterCMVAvailable sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1297-AAV-EFSNC-dCjCas9-HP1b(79-173)
Plasmid#223142PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1306-AAV-EFSNC-dSaCas9-HP1aNH(115-177)
Plasmid#223151PurposeExpression of truncated HP1a with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 115-177PromoterEF1aAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1296-AAV-EFSNC-dCjCas9-HP1aNH(115-177)
Plasmid#223141PurposeExpression of truncated HP1a with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 115-177PromoterEF1aAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1313-AAV-EFSNC-dSaCas9-MECP2(204-310)
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1307-AAV-EFSNC-dSaCas9-HP1b(79-173)
Plasmid#223152PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC-C Sars-CoV-2 S_L241-243del
Plasmid#194841PurposeSars-CoV-2 S_L241-243del in MAC-C destination vectorDepositorInsertS_L241-243del (S Sars-CoV-2)
UseTagsMAC-CExpressionMammalianMutationL241-243delPromoterAvailable sinceMay 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AGTR1-DuET
Plasmid#213183PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertAGTR1 (AGTR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx32D178Y-IRES-GCaMP6s
Plasmid#216796PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of the D178Y mutant form of Connexin 32 and cytosolic GCaMP6sDepositorInsertCx32D178Y-IRES-GCaMP6s (GJB1 Human)
UseLentiviralTagsExpressionMutationD178Y mutant form of Connexin 32PromoterAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pExp-His-zBasic-RBD-Avi
Plasmid#195000PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorInsertRBD (S SARS-CoV-2)
UseTagsAvi-tag and His8-ZbasicExpressionBacterialMutationPromoterT7lacAvailable sinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-DSep1-msfGFP
Plasmid#174494Purposebacterial expression of Drosophila Sep1 fused to monomeric superfolder GFPDepositorInsertSep1 (Sep1 Fly)
UseTagsHis6-TEV and msfGFPExpressionBacterialMutationPromoterAvailable sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ287-RVR
Plasmid#138124PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized BsCas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertBsCas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ285-RVR
Plasmid#138121PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertLb5Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RPromoterAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA E4-En-1 (GB2243)
Plasmid#160565PurposetRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInserttRNA-gRNA position E4-En-1 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorInsertFlex-P301L tau (MAPT )
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-puro
Plasmid#167821PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5(TA)-ires-puro
Plasmid#167823Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
GPER-DuET
Plasmid#213256PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPER (GPER1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9-HF1
Plasmid#201952PurposeMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNADepositorInsertMammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNA
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationPromoterCbhAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
UseTagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTR01F/hFGFR2c-V5
Plasmid#236013Purposefor PiggyBac mediated integration and stable expression of hFGFR2c proteinDepositorInserthuman FGFR2c (FGFR2 Human)
UseTagsV5/HisExpressionMammalianMutationPromotertruncated CMV promoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-TdTomato
Plasmid#191203PurposeFlpO dependent TdTomato expressionDepositorInsertTdTomato
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ERBB2-V5/HIS
Plasmid#201103Purposeexpression of human ERBB2 receptor tyrosine kinase in mammalian cellsDepositorInserthuman ERBB2 receptor tyrosine kinase, full length, wildtype (ERBB2 Human)
UseTagsV5/HisExpressionMammalianMutationPromoterCMVAvailable sinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-DuET
Plasmid#213221PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCXCR4 (CXCR4 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only