We narrowed to 6,763 results for: poly
-
Plasmid#220246PurposeExpresses an EZH2 mutant for knockout/rescue experiments in mammalian cells.DepositorInsertEZH2 mt 2* (EZH2 Human)
UseLentiviralTagsFlagExpressionMammalianMutationPRKKKR494-499NAAIRSPromoterEF-1αAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_1-pTRNA-scf 2.1 (GB2603)
Plasmid#160568PurposetRNA and scaffold 2.1 scRNA aptamer Ms2 for the assembly of GBoligomers for a single position of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_1-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_n-1] (GB1210)
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-mEGFP-pp4640
Plasmid#191846PurposeExpresses Salmon Alphavirus polyprotein with mEGFP N-terminal fusionDepositorInsertmEGFP-pp4640
TagsmEGFPExpressionMammalianMutationmEGFP fusion in Nterminal, some silent point muta…PromoterCMVAvailable SinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXs-LN
Plasmid#188231PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorUseRetroviralExpressionMammalianAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp15 (SARS-CoV-2)
Plasmid#169166PurposeBaculoviral transfer vector for the expression of SARS-CoV-2 nsp15 in insect cellsDepositorInsert3xFlag-6His-nsp15 (ORF1ab Synthetic, SARS-CoV-2)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET45b-tsr(B/X) (6X-His-Dm-Cofilin)
Plasmid#128278PurposeExpresses Drosophila melanogaster Cofilin (Twinstar) in bacterial cell cultureDepositorInserttwinstar (tsr) (tsr Fly)
Tags6X Histidine tagExpressionBacterialMutationMet1 changed to Pro1; Cys77 silent basepair mutat…PromoterT7Available SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
vipr1_L (OZ559)
Plasmid#28084DepositorInsertZinc finger array targeting vipr1 (LOC100334247 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
vipr1_R (OZ560)
Plasmid#28085DepositorInsertZinc finger array targeting vipr1 (LOC100334247 Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
CD44v-EC-His (pcDNA3)
Plasmid#238418PurposeExpresses the polyhistidine-tagged extracellular region of CD44v (CD44v-EC-His)DepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-Cyclin B1 ND
Plasmid#234706Purposeallows tethering of non degradable (ND) cyclin B1 protein to lacO repeats in specific chromatin lociDepositorAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC7 CD
Plasmid#224345PurposeExpresses human KDAC7 (HDAC7) catalytic domain in insect cellsDepositorInsertKDAC7 (HDAC7 Human)
TagsTEV-cleavable His6ExpressionInsectMutationOnly includes residues 521-942 (catalytic domain).PromoterPolyhedrinAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8ΔChromo
Plasmid#224708PurposeExpresses a human CBX8 truncation (deletion of the chromodomain) in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tagDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.mEGFP-CBX8
Plasmid#224710PurposeExpresses N-terminal hexahistidine-tagged human CBX8 in insect cells, with a monomeric variant EGFP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFB1.HMBP.PrS.CBX8
Plasmid#224707PurposeExpresses human CBX8 in insect cells, under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mFzd4-opt(40-537)-9xHis_pFastBac1
Plasmid#216378PurposeBaculovirus transfer vector to express FLAG-tagged mouse Fzd4 (codon-optimized for insect cell expression)DepositorInsertFrizzled-4 (Fzd4 Mouse)
UseBaculovirusTagsHA signal sequence-FLAGExpressionInsectPromoterPolyhedrinAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR/D-Topo CDS A. thaliana IMPORTIN ALPHA 2
Plasmid#175816PurposepENTR plasmid with CDS of Arabidopsis thaliana IMPORTIN ALPHA ISOFORM 2 (AT4G16143.1) without stop codon for C-terminal epitope tagsDepositorInsertIMPORTIN ALPHA ISOFORM 2 (IMPA-2 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneMutationnatural polymorphism P65S, annotated in Genbank f…PromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M3_3-pTRNA-scf 2.1 (GB2075)
Plasmid#160560PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M3_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM3_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_3-pTRNA-scf 2.1 (GB2073)
Plasmid#160558PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M1_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C
Plasmid#60394PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) C130S, E446C for crosslinking polyglutamate peptideDepositorInsertTUB1 (TUB1 Synthetic, Budding Yeast)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC(elavl3)-CaMPARI2
Plasmid#137185Purposepan-neuronal expression of CaMPARI2 in zebrafish, used to generate the CaMPARI2 zebrafish line at ZIRC (ZL13801)DepositorInsertHuC(elavl3)-CaMPARI2-FLAG-HA-myc-polyA
UseTol2 plasmid for zebrafishTagsFLAG, HA, mycPromoterHuC(elavl3)Available SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSSRB274_pAC8-eGFP-hsCRBN
Plasmid#218791PurposeInsect cell expression vector for FLAG-TEV-eGFP-Prescission-hsCRBNDepositorInsertProtein cereblon (CRBN Human)
TagsFLAG-TEV-eGFP-PrescissionExpressionInsectMutationeGFP fused to N-terminusPromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSSRB069_pAC8-hsDDB1dB
Plasmid#218790PurposeInsect cell expression vector for 6xHis-TEV-hsDDB1∆BDepositorInsertDNA damage-binding protein 1 (DDB1 Human)
Tags6xHis-TEVExpressionInsectMutationDeleted amino acids 396-705 and replaced with GNG…PromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only