We narrowed to 4,353 results for: erf
-
Plasmid#187844PurposeExpression of SNAPf and mEGFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
UseTagsIg k-chain leader sequence, SNAPf-tag, and meGFPe…ExpressionMammalianMutationmeGFPe: asparagine 198 to aspartic acid and tyros…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-PDGFR-WPRE
Plasmid#234439PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCjedCas9
Plasmid#172216PurposeExpresses catalytically inactive Campylobacter jejuni Cas9 (CjedCas9) in bacterial cellsDepositorInsertcatalytic mutant of Cas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
UseTagsHistagExpressionMutationchanged Asp 8 to Ala and His 559 to AlaPromoterAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
UseTagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_15
Plasmid#60322PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS PHLDA1) (PHLDA1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
UseTagsmEos2ExpressionMammalianMutationPromoterAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
UseTagsExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K197R-VA
Plasmid#191223PurposeLentiviral expression of human IFIT5_K197R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationchanged Lysine 197 to Arginine (K197R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_WT-VA
Plasmid#191221PurposeLentiviral expression of human IFIT5_WT in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationPromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K160R-VA
Plasmid#191222PurposeLentiviral expression of human IFIT5_K160R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationchanged Lysine 160 to Arginine (K160R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Human, Synthetic)
UseTagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPm-IFNAR1(28-557)
Plasmid#192784PurposeExpression of SNAPf and mXFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
UseTagsIg k-chain leader sequence, SNAPf-tag, and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPm-IFNAR1(28-557)
Plasmid#192704PurposeExpression of SNAPf and mEGFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
UseTagsIg k-chain leader sequence, SNAPf-tag, and meGFPm…ExpressionMammalianMutationmeGFPm: gluatmic acid 142 to asparagine and histi…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2 NCmut-msfGFP_SEPT6
Plasmid#180312Purposebacterial co-expression of human SEPT2 NCmut fused to monomeric superfolder GFP and of human SEPT6DepositorUseTagsHis6-TEV and msfGFPExpressionBacterialMutationSEPT2 F20D, V27DPromoterAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE1 (minus strand)
Plasmid#91842PurposeLuciferase reporter for CD69 enhancer (IGI-P0619)DepositorInsertCD69 CaRE1 (minus strand) (CD69 Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (plus strand)
Plasmid#91848PurposeLuciferase reporter for CD69 enhancer (IGI-P0625)DepositorInsertCD69 CaRE2 (plus strand) (CD69 Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (minus strand)
Plasmid#91843PurposeLuciferase reporter for CD69 enhancer (IGI-P0620)DepositorInsertCD69 CaRE2 (minus strand) (CD69 Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBig2ab zz TEV YBBR POT1 ZZ TEV TPP1 MBP TEV TIN2 ZZ TEV TRF1 (4comp1)
Plasmid#185447PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF1 and TPP1 each with a zz tag and TEV site, and human TIN2 with an MBP affinity tag and TEV site in insect cellsDepositorUseTagsMBP, YBBR, and ZZExpressionInsectMutationPromoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (plus strand)
Plasmid#91850PurposeLuciferase reporter for IL2RA enhancer (IGI-P0345)DepositorInsertIL2RA CaRE4 (plus strand) (IL2RA Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (minus strand)
Plasmid#91849PurposeLuciferase reporter for IL2RA enhancer (IGI-P0626)DepositorInsertIL2RA CaRE4 (minus strand) (IL2RA Human)
UseLuciferaseTagsExpressionMammalianMutationPerfect match to reference sequencePromoterAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only