We narrowed to 22,017 results for: his
-
Plasmid#71960PurposeExpresses the extracellular region of the NCAM1, isoform 0.0.0 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertNcam1_0.0.0 (Ncam1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHis-hPim1
Plasmid#100722PurposeExpression of human Pim1 kinase domain in E.coliDepositorInsertPim1 (PIM1 Human)
UseTagsHisExpressionBacterialMutationResidues 29-313 of isoform 2PromoterT7 promotorAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-STRHISNDHFR
Plasmid#64000PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneUseTags6xHis & Strep II (STR); TEV cleavableExpressionBacterialMutationPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
T7-PseB-His6
Plasmid#89723PurposeExpresses PseB from C. jejuni with an N-terminal T7 tag and a C-terminal His6 tagDepositorInsertPseB
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1MycHis/HIP1/ΔE
Plasmid#31252DepositorInsertHuntingtin-interacting protein 1 (HIP1 Human)
UseTagshis and mycExpressionBacterialMutationdeleted ENTH domainPromoterAvailable sinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHisAlix deltaPRD
Plasmid#42577DepositorInsertdelta-PRD ALIX (residues 1-702) (PDCD6IP Human)
UseTagsHIS-TEVExpressionBacterialMutationsilent mutation A1617G (numbering in ALIX gene)PromoterAvailable sinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMTU-DO-HIS
Plasmid#160005PurposeLow-copy expression vector for K. marxianus, histidine selectionDepositorTypeEmpty backboneUseKluyveromyces marxianusTagsExpressionYeastMutationPromotern/aAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Sema4f.b-Fc-His
Plasmid#72159PurposeExpresses the extracellular region of the Sema4F, isoform b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4f.b (Sema4f Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-AP-His
Plasmid#71941PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn3 (Cntn3 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-AP-His
Plasmid#72049PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema7a (Sema7a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3d(L)-AP-His
Plasmid#72017PurposeExpresses the Sema3D protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3d (Sema3d Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pME18S-HismSin3A
Plasmid#30454DepositorInsertSin3A (Sin3a Mouse)
UseTagsHisExpressionMammalianMutationPromoterAvailable sinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pENTR4_FLAG/HA_FUS_His6
Plasmid#26365DepositorInsertFUS (FUS Human)
UseEntry vectorTagsFLAG/HA and His6ExpressionMutationdelta 527 (stop codon)PromoterAvailable sinceOct. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
Plxna1-AP-His
Plasmid#71996PurposeExpresses the extracellular region of the PlexinA1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertPlxna1 (Plxna1 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-AP-His
Plasmid#72035PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema5a (Sema5a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRCHisB-TRF2∆B
Plasmid#53208PurposeExpressed N-terminally Hexahistine tagged TRF2 Delta Basic proteinDepositorInsertTRF2 Delta Basic (TERF2 Human)
UseTags6x HisExpressionBacterialMutationcontains amino acids 47-500PromoterTrcAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
SPOCK1_23-439_HisN_AviC
Plasmid#195876PurposeBaculovirus expression for structure determination; may not be full ORFDepositorInsertSPOCK1 (SPOCK1 Human)
UsePfhmsp-avic-lic-n, baculovirus expressionTagsExpressionMutationPromoterPolyhedrinAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema4b-Fc-His
Plasmid#72155PurposeExpresses the extracellular region of the Sema4B protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema4b (Sema4b Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only