We narrowed to 12,061 results for: shRNA
-
-
-
CBX3 A6.5 gRNA
Plasmid#90569Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1B
Plasmid#183338PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1B
UseLentiviralAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-KRAS-G12C-tmpknot-epegRNA
Plasmid#214094PurposeLentiviral vector expressing epegRNA to induce KRAS G12C mutationDepositorInsertKRAS G12C epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A5.5 gRNA
Plasmid#90568Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A5.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP2B
Plasmid#183325PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP2B geneDepositorInsertTOP2B
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP2A
Plasmid#183324PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP2A geneDepositorInsertTOP2A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PXN
Plasmid#227315PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-1x
Plasmid#164413PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-1xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E9.3 gRNA
Plasmid#90684Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFnCas12a_NT
Plasmid#169838PurposeExpresses FnCas12a and guide RNA in BacteriaDepositorInsertFnCas12a
UseCRISPRExpressionBacterialPromoterpXynAAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E2.3 gRNA
Plasmid#90881Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E2.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shSmad4
Plasmid#37046DepositorAvailable SinceJan. 18, 2013AvailabilityAcademic Institutions and Nonprofits only
