We narrowed to 65,344 results for: %s
-
Plasmid#57838PurposeLocalization: MT End Binding Protein, Excitation: 548, Emission: 561DepositorAvailable sinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pMSCV-IRES-GFP/CALR ins5
Plasmid#214701PurposeMammalian expression of human CALR ins5DepositorAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CALR wt
Plasmid#214699PurposeMammalian expression of human CALR wtDepositorAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 S100A1
Plasmid#67048PurposeStandard for cell-free expression benchmarking.DepositorAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
NG0750 pCI-TPI-PTC48-4H
Plasmid#65803PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
SARS CoV-2 HexaPro spike (bio-His)
Plasmid#166856PurposeHuman expression vector encoding full length SARS CoV-2 spike protein, containing biotinylation site and 8His-tag. Modification of Addgene plasmid #154754.DepositorInsertSARS CoV-2 HexaPro full length spike protein (S Severe acute respiratory syndrome-related coronavirus)
Tags8xHis and Biotinylation siteExpressionMammalianAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianPromoterCMVAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IDH1-R132L
Plasmid#116411PurposeLentiviral expression of IDH1 R132LDepositorAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521-myc
Plasmid#196239PurposeN-terminal GST fusion of Af1521(WT) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(WT) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
RP hk339-GFP
Plasmid#24431DepositorAvailable sinceJune 30, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLC-Flag-CSNK1A1 G40N-Puro
Plasmid#123320PurposeLentiviral vector for expression of Flag tagged CK1alpha G40N-P2A-Puro casette from a CMV promoterDepositorInsertCSNK1A1 (CSNK1A1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationchanged Glycine 40 to AsparaginePromoterCMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p175 Grg-1s HA
Plasmid#11064DepositorAvailable sinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pICH71411
Plasmid#50345DepositorInsert3'UTR, polyadenylation signal/terminator, RbcS3C (S. lycopersicum )
UsePlant expressionMutationBsaI/BbsI sites removed by point-mutationAvailable sinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Frt-hspB5
Plasmid#63096PurposeExpression of HSPB5 (small HSP) in mammalian cellsDepositorAvailable sinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mCherry-Ezrin-C-14
Plasmid#55042PurposeLocalization: Focal Adhesions/Membrane, Excitation: 587, Emission: 610DepositorAvailable sinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIFU002
Plasmid#174299PurposeEncodes the SARS-CoV-2 Spike Receptor Binding Domain (RBD) with the N501Y mutation and can be combined with pJS697 (Addgene plasmid # 168778) through homologous recombinationDepositorInsertSpike RBD N343Q, N501Y (S Severe acute respiratory syndrome coronavirus 2)
TagsHA and cMycExpressionYeastMutationN343Q, N501YAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only