We narrowed to 25,574 results for: promoter
-
Plasmid#109388PurposeGFP cassette under the control of the htpG2 sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertphtpG2-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 beta-catenin Y654E
Plasmid#16073DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPANI2A2E2-Crimson
Plasmid#193758PurposeExpresses E2-Crimson under the control of PANI2 synthetic promoter, ColE1 origin of replication, Ampicillin selectionDepositorInsertE2-Crimson
UseSynthetic BiologyExpressionBacterialPromoterPANI2 synthetic promoter carrying binding sites f…Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E1.1-RFP
Plasmid#22928DepositorInsertE1.1 binding site from Scardigli et al., 2003 with minimal CMV
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
MBD1v1 pcDNA3.1
Plasmid#78140PurposeMammalian expression of MBD1v1DepositorAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEBG-TFII-I delta isoform
Plasmid#22188DepositorAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pENTR_hEMSY
Plasmid#125156PurposeGateway entry cloneDepositorInsertEMSY (EMSY Human)
UseGateway CloningAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
NK73
Plasmid#176609PurposeTo test bead engulfment of macrophages.DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
USP19 sgRNA2
Plasmid#78586Purposedelete USP19 gene in human cellDepositorAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
TOPO pTRE
Plasmid#68457PurposeTOPO construct expressing pTRE for generation of GMAP-compatible promoterDepositorInsertTetracycline Response Element Promoter
UseGmapExpressionBacterialPromoterPlacAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
1456_pDEST_miniTol2_R4-R2_Cryst-eGFP
Plasmid#171795PurposepDEST miniTol2-clone for R4-R2 3-component gateway assembly (p5E + pME). Include a eGFP selection marker (Crystallin promoter Lens/Eyes)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR9/9*
Plasmid#177805PurposeThe pre-miR-9/9* sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-9/9*
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPath-pTac-integrase
Plasmid#199999PurposeEntry vector for biosynthetic pathway. pTac-phiC31 integrase. This material contains 2 plasmids. For more information look under the "Depositor Comments" section below.DepositorInsertPathways
ExpressionBacterialAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO Plk4 KD-mCherry
Plasmid#80270Purposemammalian expression plasmid for kinase dead Plk4DepositorAvailable SinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-N1IC
Plasmid#47612Purposebacterial expression of GST-myc-Notch1 ICDepositorInsertNotch1 intracellular domain (Notch1 Mouse)
TagsGST and mycExpressionBacterialMutationcontains amino acids 1753-2531PromotertacAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_human-4xUAS
Plasmid#125150PurposeVector to measure the activity of CP candidates in response to a tethered (4xUAS) GAL4-DBD-COF by determining the abundance of transcripts originating from each candidate in human cellsDepositorInsert4 x upstream activating sequence (UAS)
UseStap-seq screening vectorAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crScaffold_SV40-BFP
Plasmid#224860PurposecrRNA scaffold for RfxCas13d expressed from hU6 promoter and reporter BFP protein expressed from SV40 promoterDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEBG-TFII-I-p70
Plasmid#22187DepositorInsertTFII-I (GTF2I Human)
TagsGST and HisExpressionMammalianMutationContains only amino acids 1-735 C-terminal residu…Available SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RAB10 Q68L-WPRE-UbC-Emerald
Plasmid#203803PurposeLentiviral vector plasmid expressing human RAB10 mutation Q68L (constitutively active mutant) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only