We narrowed to 25,161 results for: promoter
-
Plasmid#87945PurposeExpresses estradiol-inducible synthetic transcription factor in yeast under control of GAL1 promoter. It activates transcription of promoters containing Zif268 binding sites.DepositorInsertpGAL1- Zif268 DBD - hPR LBD - MSN2 AD (PGR Human, Budding Yeast)
ExpressionYeastPromoterGAL1Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RAB10 T23N-WPRE-UbC-Emerald
Plasmid#203802PurposeLentiviral vector plasmid expressing human RAB10 mutation T23N (dominant negative mutant) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pILGFPU0 (R)
Plasmid#83562PurposeExpress yEGFP-ERG9 ER targeting peptide-CLN2PEST under the control of TEF1 promoterDepositorInsertTEF1 promoter-yEGFP-ERG9 ER targeting peptide-CLN2PEST
ExpressionYeastPromoterTEF1Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Alpha (JCE599)
Plasmid#89779Purposeyeast expression of mouse PKC Alpha with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
mRuby2-AKTIP
Plasmid#171942PurposeExpresses AKTIP in mammalian cellsDepositorAvailable SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-Dusp6DM_S159/197A
Plasmid#67684Purpose3' entry clone with activated Dusp6 (S159/167A)DepositorInsertdusp6 (dusp6 Zebrafish)
MutationS159A, S197AAvailable SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNRB143
Plasmid#36452DepositorAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET21a - Mtb-TF
Plasmid#111513PurposeExpresses M. tuberculosis Trigger Factor with a C-terminal His tagDepositorInsertTrigger Factor
TagsHis tagExpressionBacterialPromoterT7Available SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF6 rglut1 HA complete
Plasmid#89572Purposerglut1 HA completeDepositorInsertpEF6 rglut1 HA complete (Slc2a1 Rat)
TagsV5-His A, B, C and rglut1 HA completeExpressionMammalianPromoterEF-1αAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQE9-His-p97deltaD2
Plasmid#17229DepositorAvailable SinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJH131
Plasmid#48260PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae GAL10/GAL1 bidirectional promoter in yeast.DepositorInsertsURA3 3' fragment
URA3 5' fragment
GAL10/GAL1 bidirectional promoter
UseRoutine cloning vectorMutation-242 upstream to URA3 ORF +495 and URA3 ORF from …PromoterGAL10/GAL1 bidirectionalAvailable SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEBB-3XMyc-TRAF2 S11A
Plasmid#44105DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFIN-IRBP1783-CHER
Plasmid#44357DepositorInsertIRBP1783-CHER
UseLentiviralPromotermurine interphotoreceptor retinoid-binding protei…Available SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBR322-bom
Plasmid#155178PurposepBICI_2_strong without bom siteDepositorInsertsSucrose Phosphorylase from Bifidobacterium adolescentis (BAD_RS00415 Bifidobacterium adolescentis)
Cellobiose phosphorylase from Cellulomonas uda
UseSynthetic BiologyTagsHis Tag and Strep - Tag IIExpressionBacterialAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBP-Bba_K822000
Plasmid#74094PurposeL-Lactate inducible promoter from E. coli MG1655DepositorInsertBba_K822000 (L-Lactate promoter - E. coli MG1655)
UseSynthetic BiologyExpressionBacterialPromoterNAAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
RNA polymerase beta prime subunit FLAG
Plasmid#102337PurposeTargeting plasmids for replacing the S. elongatus PCC 7942 genomic copy of Synpcc7942_1524 (Beta prime subunit of RNA polymerase) with a C-terminal FLAG tagged variant.DepositorInsertRNAP Beta Prime Subunit with C-terminal FLAG TAG
Tags3x FLAG with 3X GSGS linkerAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK-flag-GFP 1-10 tetra Cys
Plasmid#78589PurposeExpression flag-GFP 1-10 tetra Cys in mammalian cellsDepositorInsertflag-GFP 1-10 tetra Cys
TagsflagExpressionMammalianPromoterCMVAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCK300
Plasmid#87766Purposeempty control plasmid, three terminators to place inserts between for insulation, ampR, pBR322 origin, lacIDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterNoneAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJJF439_PU6_empty_sgRNAscaffold - sgRNA cloning backbone
Plasmid#164266PurposesgRNA cloning backbone for expression of sgRNA in C. elegans. Contains BbsI sites for insertion of spacer sequences. U6 promoter from W05B2.8 gene.DepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6 promoter from W05B2.8Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only