1,859 results
-
Plasmid#200171PurposePflp-18 LoxP EBFP (stop) LoxP twk-40(gf) GFP unc-54 3' UTR C.elegans AVA and other neurons expression of twk-40(gf) GFPDepositorInserttwk-40 (twk-40 Nematode)
UseTagsGFPExpressionWormMutationPromoterPflp-18Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4506
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPnpr-4Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4562
Plasmid#200780PurposePflp-18 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of GtACR2 RFPDepositorInsertGtAR2
UseTagsmCherryExpressionWormMutationPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4609
Plasmid#200781PurposePpdf-1 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVB and other neurons expression of GtACR2 RFPDepositorInsertGtACR2
UseTagsmCherryExpressionWormMutationPromoterPpdf-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4677
Plasmid#200782PurposePnpr-4 ins-22::GFP unc-54 3' UTR C.elegans AVA and other neurons expression of ins-22 GFPDepositorInsertins-22 (ins-22 Nematode)
UseTagsGFPExpressionWormMutationPromoterPnpr-4Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4693
Plasmid#200784PurposePtwk-40s EGFP unc-54 3' UTR C.elegans AVA and other neurons expression of EGFPDepositorInsertno
UseTagsGFPExpressionWormMutationPromoterPtwk-40sAvailable sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4783
Plasmid#200785PurposePnpr-4 snb-1::pHluorin unc-54 3' UTR C.elegans AVA and other neurons expression of snb pHluorinDepositorInsertsnb-1 (snb-1 Nematode)
UseTagspHiuorinExpressionWormMutationPromoterPnpr-4Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2829
Plasmid#199693PurposePcex-1 tomm-20::miniSOG UrSL mCherry unc-54 3' UTR C.elegans RIM neuron expression of miniSOG RFPDepositorInsertminiSOG
UseTagsRFPExpressionWormMutationPromoterPcex-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH3830
Plasmid#200038PurposePrig-3 zif-1 SL2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of zif RFPDepositorInsertZIF (zif-1 Nematode)
UseTagsmCherryExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4018
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorInsertzif-1 (zif-1 Nematode)
UseTagsEBFPExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS110
Plasmid#215674PurposeSplit hygromycinR landing pad insertion plasmid for ChrIIIDepositorInsert5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA
UseCRISPR and Cre/LoxTagsExpressionWormMutation3' ∆HYGR is promoterless and encodes aa60-341PromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAH64 - [AFDp | gfp | tbb-2 UTR]
Plasmid#200338Purposegfp BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00001535, gcy-8Available sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorUseTagsExpressionWormMutationE490GPromoterAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT348
Plasmid#204515PurposeBacterial expression of CEC-5 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of cec-5 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH50 - [PVQp | gfp | tbb-2 UTR]
Plasmid#200326Purposegfp BioPart for PVQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVQp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00003755, nlp-17Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH47 - [ADLp | mScarlet | tbb-2 UTR]
Plasmid#200323PurposemScarlet BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | wrmscarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011644, T09B9.3Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH80 - [AWAp | gfp | tbb-2 UTR]
Plasmid#200354Purposegfp BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR]
Plasmid#200357PurposemScarlet BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011327, hlh-34Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR]
Plasmid#200353PurposemScarlet BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH63 - [AFDp | wrmScarlet | tbb-2 UTR]
Plasmid#200337PurposemScarlet BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00001535, gcy-8Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB109
Plasmid#199322PurposeCombine with Gal4 to direct CaMBI 300 expressionDepositorInsert15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
UseTagsExpressionWormMutationOrange CaMBI with 300 nM KD for calciumPromoter15xUAS:::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB91
Plasmid#199319PurposeCombine with Gal4 to direct ACR1 expressionDepositorInsert15xUAS::delta pes-10::::ACR1::let-858 3'UTR
UseTagsExpressionWormMutationPromoter15xUAS::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB88
Plasmid#199321PurposeCombine with Gal4 to direct TeNL expressionDepositorInsert15xUAS::delta pes-10::::TeNL::let-858 3'UTR
UseTagsExpressionWormMutationKD for calcium is 250 nM, 1 synthetic intronPromoter15xUAS::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT353
Plasmid#204506PurposeIn vitro transcription of RNA probes for in situ hybridization of CeRep55 lncRNAs in nematode (after linearization with NotI and BglI)DepositorInsertCeRep55 tandem repeats from Y73B3A (C. elegans)
UseOtherTagsExpressionMutationPromoterdouble-T7Available sinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT346
Plasmid#204505Purpose5S rDNA used as a probe for chromosome FISH in nematodeDepositorInsert5S rDNA (C. elegans)
UseOtherTagsExpressionMutationPromoterT7Available sinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT318
Plasmid#204508Purposerpl-21 promoter-driven C04F12.1 construct tagged with 2xHA for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsertrpl-21p::2xHA::C04F12.1 (C. elegans)
UseTags2xHAExpressionWormMutationPromoterrpl-21 (C. elegans)Available sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT246
Plasmid#204507Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsert2xFLAG::csr-1 (C. elegans) (csr-1 Nematode)
UseTags2xFLAGExpressionWormMutationPromotercsr-1 (C. elegans)Available sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT334
Plasmid#204516PurposeBacterial expression of COH-3 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of coh-3 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT203
Plasmid#204512PurposeBacterial expression of C04F12.1 with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertC04F12.1 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT239
Plasmid#204522PurposeIn vitro transcription of Mos1 transposase mRNA with SL1 and poly(A) used for microinjection into nematodeDepositorInsertMos1_transposase::glh-2_3'UTR (glh-2 Nematode)
UseOtherTagsExpressionMutationPromoterT7 (minimum seq.)Available sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT517
Plasmid#204518PurposeBacterial expression of CEC-4 with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertcec-4 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT186
Plasmid#204513PurposeBacterial expression of CSR-1 PAZ domain with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertPAZ domain of csr-1 (C. elegans) (csr-1 Nematode)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT521
Plasmid#204520PurposeBacterial expression of CEC-5 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-5 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT182
Plasmid#204511PurposeBacterial expression of catalytically defective CSR-1a with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertcsr-1a with D769A mutation (C. elegans) (csr-1 Nematode)
UseTags6xHis, MBPExpressionBacterialMutationD769APromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT520
Plasmid#204519PurposeBacterial expression of CEC-8 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-8 (C. elegans) (Y55B1BR.3 Nematode)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT342
Plasmid#204514PurposeBacterial expression of SYP-1 N-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertN-terminal fragment of syp-1 (C. elegans)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT320
Plasmid#204517PurposeBacterial expression of HIM-1 internal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertInternal fragment of him-1 (C. elegans) (him-1 Nematode)
UseTags6xHis, MBPExpressionBacterialMutationPromoterT7lacAvailable sinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmCardinal-T2A-HO1
Plasmid#197249PurposeExpresses the protein of wmCardinal-T2A-HO1 in neurons of C. elegansDepositorInsertwmCardinal-T2A-HO1
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP720-T2A-HO1
Plasmid#197248PurposeExpresses the protein of wmiRFP720-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP720-T2A-HO1
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmNeonGreen
Plasmid#197242PurposeExpresses the protein of wNeonGreen in neurons of C eleganDepositorInsertwmNeonGreen
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJR017
Plasmid#198835PurposeIn vivo blocking of synaptic signaling through Tetanus toxin mediated cleavage of synptobrevin proteins.DepositorInsert15xUAS::TeTX-SL2-mKate::let-858 3'UTR
UseTagsExpressionWormMutationPromoterAvailable sinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClα.CreON
Plasmid#196995PurposeCre recombinase dependent expression of GluClv2.0 alpha subunit. GluClα contains a Cerulean tag. When co-expressed with GluClv2.0 beta subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClα -Cerulean
UseAAV and Cre/LoxTagsCeruleanExpressionMutationPromotershort CAGAvailable sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH86 - [AWCp | gfp | tbb-2 UTR]
Plasmid#200360Purposegfp BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00012770, srt-47Available sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH82 - [PVTp | gfp | tbb-2 UTR]
Plasmid#200356Purposegfp BioPart for PVT neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVTp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006979, zig-2Available sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH84 - [AVHp | gfp | tbb-2 UTR]
Plasmid#200358Purposegfp BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011327, hlh-34Available sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only