We narrowed to 23,099 results for: crispr
-
Plasmid#178279PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.S.V5_mCherry-NLS
Plasmid#178278PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.S.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.V5_mCherry-NLS
Plasmid#178277PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.S_mCherry-NLS
Plasmid#178273PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE4566
Plasmid#88904PurposeExpresses MbCpf1 crRNA and inactive/dead, humanized MbCpf1 nucleaseDepositorInsertsMb crRNA
hMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMV and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-MFAP2
Plasmid#185555PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting MFAP2DepositorInsertMFAP2 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSExpressionMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-SOX4
Plasmid#185552PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting SOX4DepositorInsertSOX4 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-Halo-CD4-bla
Plasmid#179451PurposeDonor vector to knock in Halotag C-terminal to human PER2 geneDepositorAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PE VQR
Plasmid#162797PurposeAll-in-one prime editor piggyBac transposon, VQR variantDepositorInsertSpCas9_H840A_VQR-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135V, R1335Q, T1337RPromoterCAGAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-Luciferase-hvTK-bla
Plasmid#179444PurposeDonor vector to knock in firefly Luciferase C-terminal to human CRY1 geneDepositorInsertLuciferase
UseCRISPRTagsHis/FlagExpressionMutationPromoterNoneAvailable SinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
UseTagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationPromoterAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
BE3(E63Q)-P2A-EGFP (pRZ189)
Plasmid#123613PurposeCAG promoter expression plasmid for rAPOBEC1(E63Q)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (catalytically impaired BE3 mutant).DepositorInsertBE3(E63Q)-P2A-EGFP
UseTagsExpressionMammalianMutationE63Q in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-SNAP-CD4-bla
Plasmid#179447PurposeDonor vector to knock in SNAPtag C-terminal to human CRY1 geneDepositorInsertSnapTag
UseCRISPRTagsHis/FlagExpressionMutationPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.S.VSVg_mCherry-NLS
Plasmid#178269PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.S.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.VSVg_mCherry-NLS
Plasmid#178261PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.S_mCherry-NLS
Plasmid#178260PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.S.VSVg_mCherry-NLS
Plasmid#178255PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.S.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.VSVg_mCherry-NLS
Plasmid#178246PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.S_mCherry-NLS
Plasmid#178245PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.VSVg_mCherry-NLS
Plasmid#178241PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.S_mCherry-NLS
Plasmid#178240PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.HSV_mCherry-NLS
Plasmid#178237PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.HSV and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.VSVg_mCherry-NLS
Plasmid#178225PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE3328
Plasmid#107539PurposeExpresses As crRNA and human codon optimized AsCpf1(RR mutant) in mammalian cells.DepositorInsertsAs crRNA
hAsCpf1(RR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationS542R, K607RPromoterCMV and human U6Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Olig2 x2)
Plasmid#171101PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Olig2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.Ollas_mCherry-NLS
Plasmid#178223PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.V5_mCherry-NLS
Plasmid#178221PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.Ollas_mCherry-NLS
Plasmid#178218PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.V5_mCherry-NLS
Plasmid#178215PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.Ollas_mCherry-NLS
Plasmid#178212PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorInsertPLK1 (PLK1 Human)
UseCRISPR and LentiviralTagsBFPExpressionMammalianMutationPromoterU6Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT526
Plasmid#180513PurposePlasmid expressing mammalian codon optimized wt PlmCasX, mNeonGreen, sgRNAv1 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv1
PlmCasX-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianMutationPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.S_mCherry-NLS
Plasmid#178276PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.Ollas_mCherry-NLS
Plasmid#178259PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.NWS_mCherry-NLS
Plasmid#178258PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.NWS and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE3329
Plasmid#107538PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationG532R, K595RPromoterCMV and human U6Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3327
Plasmid#107535PurposeExpresses As crRNA and human codon optimized AsCpf1(RVR mutant) in mammalian cells.DepositorInsertsAs crRNA
hAsCpf1(RVR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationS542R, K548V, N552RPromoterCMV and human U6Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsExpressionMammalianMutationPromoterCMV and U6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
nCas9-UGI control for Target-AID (pRZ1047)
Plasmid#131299PurposeCAG promoter expression plasmid for NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP (Target-AID without pmCDA1).DepositorInsertNLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP
UseTagsExpressionMammalianMutationPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE3334
Plasmid#107537PurposeExpresses Mb crRNA and human codon optimized MbCpf1(RVR mutant) in mammalian cells.DepositorInsertsMb crRNA
hMbCpf1(RVR mutant)
UseTags3xHA and NLSExpressionMammalianMutationN576R, K582V, N586RPromoterCMV and human U6Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3330
Plasmid#107534PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RVR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RVR mutant)
UseTags3xHA and NLSExpressionMammalianMutationG532R, K538V, Y542RPromoterCMV and human U6Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AcrIIC1X* (AcrIIC1X-mCherry chimera)
Plasmid#128114PurposeExpresses AcrIIC1(N3F/D15Q/A48I) fused to mCherry; mediates potent inhibition of both, N. meningitidis as well as S. aureus Cas9DepositorInsertAcrX* (AcrIIC1 N3F/D15Q/A48I fused to mCherry)
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE3336
Plasmid#107541PurposeExpresses Mb crRNA and human codon optimized MbCpf1(RR mutant) in mammalian cells.DepositorInsertsMb crRNA
hMbCpf1(RR mutant)
UseTags3xHA and NLSExpressionMammalianMutationN576R, K637RPromoterCMV and human U6Available SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only