We narrowed to 16,816 results for: RAN-1
-
Plasmid#159863PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mCardinal(900bp PATCs, NLS, no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-IP3KC
Plasmid#134603PurposeExpresses IP3KC GFP taggedDepositorAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-HCF-1rep1E10A
Plasmid#84607PurposePlasmid contains HCF-1rep1E10A with GST-tagDepositorAvailable SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-HCF-1rep1wt
Plasmid#84606PurposePlasmid contains HCF-1rep1wt with GST-tagDepositorAvailable SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP(L566,567A)-shTACC3
Plasmid#69117PurposeDual-promoter plasmid to express knockdown-proof human TACC3 (L566A and L567A substitutions) tagged with EGFP along with shRNA to knock down endogenous TACC3 in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationLL (566-567aa) mutated to AA. Silent mutations i…PromoterCMVAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSETC-RdgBbeta-splice variant 1
Plasmid#58276Purposebacterial expression of human RdgBbeta splice variant 1DepositorAvailable SinceAug. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
TFORF0118
Plasmid#141525PurposeLentiviral vector for overexpressing the FOXM1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mCherry
Plasmid#226567PurposeEncodes siRNA resistant SigmaR1 protein labeled with mCherryDepositorAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLP-FRT.iGluSnFR3.v857.SGZ
Plasmid#196224PurposeFluorescent reporter for glutamate, third generation, variant 857 in SGZ backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn FLP-FRT iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A4_STOP
Plasmid#161148PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A4 (SLC25A4 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-rAPOBEC1-gs-XTEN-gs-hdLbCas12a(D832A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(LbBE1.1) (RTW1295)
Plasmid#114085PurposeCAG promoter expression plasmid for human codon optimized LbBE1.1DepositorInserthuman codon optimized DNase-inactive (D832A) LbCas12a fused to N-terminal rAPOBEC1 and C-terminal UGI (LbBE1.1)
TagsSV40 NLSExpressionMammalianMutationD832AAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP
Plasmid#103815PurposeSoluble BLInCR construct that can interact with PHR constructs upon illumination with blue lightDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD44v-EC-His (pcDNA3)
Plasmid#238418PurposeExpresses the polyhistidine-tagged extracellular region of CD44v (CD44v-EC-His)DepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb-IRES2-EGFP
Plasmid#204354PurposeExpresses wild-type PDGFRb gene.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
p199 Dync1i2.C (Ex1a)
Plasmid#26449DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform C (exon 1a) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCSC-NGN2-IRES-ISL1-T2A-LHX3
Plasmid#221814PurposeLentiviral vector expressing human NEUROG2, ISL1 and LHX3 for inducing pluripotent stem cells into cholinergic motor neurons.DepositorUseLentiviralExpressionMammalianPromoterCMVAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flrt3-Fc-His
Plasmid#72075PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX304-ARNT
Plasmid#203578PurposeExpresses wild-type ARNT in mammalian cells.DepositorAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only