We narrowed to 8,816 results for: CAG
-
Plasmid#220577PurposeTo inducibly knockdown CCND1 expressionDepositorInsertCCND1 shRNA1 (CCND1 Human)
UseLentiviralTagsExpressionMutationPromoterTRE3G (TetOP) promoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GLP1R-DuET
Plasmid#213253PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGLP1R (GLP1R Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2a KI
Plasmid#131486PurposeEndogenous tagging of GluN2a: N-terminal (amino acid position: A25)DepositorInsertgRNA and GFP donor (Grin2a Rat)
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
GCGR-DuET
Plasmid#213250PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGCGR (GCGR Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-COX8A
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU67Available sinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorInsertshNRF2v1 (NFE2L2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorInsertsgRNA Targeting C-terminus of PEX3 (PEX3 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAS_4xMma PylT_FLAG-PcKRS
Plasmid#140022PurposePlasmid with 4xMmaPylT cassette and MmaPylRS for amber suppression and incorporation of photocaged-lysine; for transient or stable piggyBac-mediated integrationDepositorInsertPcKRS (pylS Methanosarcina bakeri)
UseTagsFLAGExpressionMammalianMutationM241F, A267S, Y271C, L274MPromoterEF1Available sinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorInsertgRNA and GFP donor (Grin2b Rat)
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1_puro_shNRF2-1
Plasmid#230086PurposeshRNA silencing human NRF2 geneDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_nsgRNA(PP7)
Plasmid#232436PurposensgRNA for PE3b correction of the rd12 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA2
Plasmid#220578PurposeTo inducibly knockdown CCND1 expressionDepositorInsertCCND1 shRNA2 (CCND1 Human)
UseLentiviralTagsExpressionMutationPromoterTRE3G (TetOP) promoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA non target
Plasmid#223698PurposegRNA control for dPspCas13b-FTODepositorInsertgRNA target sequence for luciferase control
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
BLBP-GFP
Plasmid#63174PurposeExpressing GFP from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorInsertBLBP (Fabp7 Mouse)
UseTagsExpressionMammalianMutationPromoter1700bp upstream of BLBP geneAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAc-C Med12His
Plasmid#49240Purposeexpresses human Med12 with His tag in insect cellsDepositorInsertMed12 (MED12 Human)
UseTagsHisExpressionInsectMutationPromoterPolyhedrinAvailable sinceNov. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-5
Plasmid#193671PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
Plasmid#209198PurposeMutagenesis of ThDepositorInsertTh (Th Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterCMVAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA1
Plasmid#223519Purposeknocking out hGSDME in human cellsDepositorInsertGSDME (GSDME Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC94-pmax-dCas9VP160-2A-puro
Plasmid#48226PurposedCas9VP160-2A-puro (puro-selectable) on pmax expression vecor. Note: This is being tested.DepositorInsertdCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro
UseCRISPRTags2A-puro, HA Tag, and VP160ExpressionMammalianMutationD10A;H840A (catalytically inactive)PromoterCAGGSAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001162487)
Plasmid#76139Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorInsertTRIM28 (TRIM28 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shLacZ
Plasmid#223222Purposemir30 based shRNA strategy, control shRNADepositorInsertshLacZ
UseAAVTagsExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgCTNNB1 Nicking
Plasmid#169845PurposeExpress a nicking sgRNA used for installation of the oncogenic S45F or S45del in Ctnnb1 in mouse liver.DepositorInsertsgCTNNB1 Nicking (Ctnnb1 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
AP1muA single guide RNA
Plasmid#230030Purposeguide RNA for AP1muA tagging at the C-terminus in pX459DepositorInsertAP1M1 guide (AP1M1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
UseTagsExpressionMammalianMutationPromoterHuman U6Available sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only