We narrowed to 5,537 results for: PID
-
Plasmid#133425PurposeHuman ARC105 coding sequence in vector for bacterial expression of GST fusion protein.DepositorInsertPCQAP (MED15 Human)
ExpressionBacterialMutationContains amino acids 1-95 or ARC105 fused to the …Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-TP1107(Q15TAG)
Plasmid#247462PurposeBacterial expression of anti-IgG VHH clone TP1107 with amber stop codon at Q15 for unnatural amino acid incorporationDepositorInsertTP1107 Q15TAG
TagsHis6 and TEV protease cleavage siteExpressionBacterialMutationOriginal Q15 codon (CAA) was modified to amber st…PromoterT7Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Puro-CAG-JEDI-2P
Plasmid#179458PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P expressed under strong mammalian promoter (CAG)DepositorInsertJEDI-2P
ExpressionMammalianPromoterCAGAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-HIV RT-6xHis-RBS-prot
Plasmid#159149Purposeexpresses His-tagged HIV reverse transcriptase and untagged HIV proteaseDepositorInsertsHuman immunodeficiency virus 1 (HIV-1) reverse transcriptase
Human immunodeficiency virus 1 (HIV-1) protease
TagsHisExpressionBacterialMutationHIV-1 group M/subtype B – BH10 strainAvailable SinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMXS-IRES-Blast ACSL4
Plasmid#173164PurposeRetroviral vector to express sgRNA resistant human ACSL4DepositorInsertAcyl-CoA Synthetase Long Chain Family Member 4 (ACSL4 Human)
UseRetroviralMutationSynonymous mutations at sgRNA sitesPromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-hACE2
Plasmid#173431Purposeprotein expression plasmid of LgBiT-hACE2-IgG1 FcDepositorAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_6P-D614G
Plasmid#172734PurposeExpression vector for SARS-CoV-2 (HexaPro-D614G) spike used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3
Plasmid#73205PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in nuclei of mammalian cells. (MBIC5, dL5**, FAP)DepositorInsertNLS-myc-dL5-2XG4S-mCer3 (MYC Human, Synthetic)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable SinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorInsertsMutL E32K
Lambda Beta
XylS
ExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h
Plasmid#113050Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1h in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based DA sensor GRAB_DA1h (DRD2 Human)
UseAAVPromoterhSynAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE
Plasmid#179464PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-701pUC19-tNGFR-P2A-FOXP3
Plasmid#186114PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1m
Plasmid#113049Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1m in neuronsDepositorHas ServiceAAV9InsertGPCR activation based DA sensor GRAB_DA1m (DRD2 Human)
UseAAVPromoterhSynAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394
Plasmid#128387PurposeExpresses a split firefly luciferase reporter based on the full length, human Gal8 and CALCOCO2, which interact following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsCLuc394 and NLuc398ExpressionMammalianPromoterEFS and IRESAvailable SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only