We narrowed to 5,271 results for: crispr cas9 expression plasmids
-
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
Plasmid#107313PurposeEncoding aCamkII-mCherry-CreDepositorInsertaCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA
UseAAVExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH-STEME-1-esgRNA
Plasmid#138135PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pV1200
Plasmid#111429PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE7.10-F148A
Plasmid#132946PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertABE7.10(F148A)
UseCRISPR; Base editorExpressionMammalianMutationABE7.10(F148A)Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
hA3A-BE3 (pRZ215)
Plasmid#131314PurposeCAG promoter expression plasmid for hA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS2601_AAV-Nme2-ABE8e-i1-U6-2xSapI
Plasmid#201683PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 and U6 sgRNA cassette. SapI enables cloning new spacers.DepositorInsertNme2-ABE8e-i1
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionPromoterT3 promoterAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ79 All-in-one AAV-U1a-NmeABE8e-2xBPSV40-U6-Rosa26_V2
Plasmid#199261PurposeOptimized single AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting mouse Rosa26 gene. This optimized construct showed improved in vivo editing efficiency.DepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1a promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS143
Plasmid#122377PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
hAID-BE3 (pRZ352)
Plasmid#131316PurposeCAG promoter expression plasmid for hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUF-LbCpf1-pre-gRNA
Plasmid#137848PurposeLbCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertLbCpf1-NLS-FLAG and gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-AsCpf1-pre-gRNA
Plasmid#137849PurposeAsCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertAsCpf1 and pre-gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only