We narrowed to 14,484 results for: SHR
-
Plasmid#73146PurposeSmall fragment of split HRP and FKBP fused to the extracellular terminus of the "post mGRASP" scaffold published by Magee, in which the majority of the NLG1 extracellular domain is deleted.DepositorInsertsHRPb-FKBP-post mGRASP
TagsHA tagExpressionMammalianPromoterCAGAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-lox-GFP shRNA p19-2
Plasmid#14091DepositorAvailable SinceFeb. 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral nontargeting shRNA RFP i670
Plasmid#155287PurposeLentiviral expression of nontargeting shRNA, RFP i670 expression, based on Addgene 12247DepositorInsertNontargeting shRNA
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER retro puro GFP shRNA
Plasmid#30519DepositorInsertGFP shRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-GFP-shRNA-GluN1
Plasmid#182502PurposeExpresses shRNA against mouse NMDA receptor NR1 subunit. Flexed cassette driven by hdc (pan neuronal) gene promoterDepositorInsertpan neuronal promoter (hdc basal promoter) driving flexed-GFP-mir30-shRNA NR1 cassette
UseAAV, Cre/Lox, and RNAiExpressionMammalianPromoterfragment of histidine decarboxylase gene promoter…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-GFP-shRNA-scramble
Plasmid#182503PurposeExpresses scramble shRNA for control expts. Flexed cassette driven by pan neuronal gene promoterDepositorInsertpan neuronal promoter driving flexed GFP-shRNA scramble from mir 30 cassette
UseAAV, Cre/Lox, and RNAiExpressionMammalianPromoterhSyn promoterAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro human lipin 1-1 shRNA
Plasmid#32019DepositorInsertlipin1 shRNA
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 GFP B56 gamma3 shRNA 14-1
Plasmid#10681DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Lrig1_shRNAmir_3
Plasmid#178049PurposeCAG tdGFP Lrig1 shRNAmir-3 cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertLrig1 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Lrig1_shRNAmir_2
Plasmid#178048PurposeCAG tdGFP Lrig1 shRNAmir-2 cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertLrig1 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-L-bpA-2xSV40pA-L-tdGFP-Lrig1_shRNAmir_1
Plasmid#178047PurposeCAG tdGFP Lrig1 shRNAmir-1 cre/lox expression piggyBac transposon (bpA 2xSV40pA stop)DepositorInsertLrig1 shRNAmir
UseCre/Lox and RNAi; PiggybacExpressionMammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-GFP-miRE_shRen-Blast
Plasmid#135682PurposeConstitutive expression (EF1a promoter) of GFP cDNA plus miRE-embedded shRenilla (control shRNA), Blasticidin selectionDepositorInsertshRenilla
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 GFP B56 alpha shRNA 6-3
Plasmid#10680DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSUPER retro puro macroH2A1 shRNA
Plasmid#30517DepositorInsertmH2A1 shRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDC-DIO-GFP-shRNA.scramble
Plasmid#184331PurposeExpresses scramble shRNA for control expts. Flexed (DIO) cassette driven by hdc promoter fragment for pan neuronal expressionDepositorInserthdc pan neuronal gene promoter, flex switch, GFP, scramble shRNA
UseAAV, Cre/Lox, Mouse Targeting, and RNAiExpressionMammalianPromoterhistidine decarboxylase promoter fragment that g…Available SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinFL
Plasmid#187272PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUPER retro puro macroH2A2 shRNA
Plasmid#30518DepositorInsertmH2A2 shRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1605-shRNAres_W
Plasmid#147889PurposeMammalian Expression of HsNot1iso1_1-1605-shRNAresDepositorInsertHsNot1iso1_1-1605-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1_1-1840-shRNAres_W
Plasmid#147891PurposeMammalian Expression of HsNot1iso1_1-1840-shRNAresDepositorInsertHsNot1iso1_1-1840-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only