We narrowed to 5,977 results for: crispr cas9 expression plasmids
-
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.20m-eVRQR-P2A-EGFP (LLH569)
Plasmid#242656PurposeCMV promoter expression plasmid for human codon optimized ABE8.20 A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.20m-VRQR-S55R-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA, eVRQR mutations in SpC…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8e-eVRQR-P2A-EGFP (HES1425)
Plasmid#242657PurposeCMV promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8e-SpCas9-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA, eVRQR mutations in SpCas…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-SpG-P2A-EGFP (BKS965)
Plasmid#242652PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpG(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpG-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, SpG mutations in SpCas9…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-VRQR-P2A-EGFP (BKS971)
Plasmid#242653PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with nVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-VRQR-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, VRQR mutations in SpCas…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-eVRQR-P2A-EGFP (BKS974)
Plasmid#242655PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, eVRQR mutations in SpCa…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABEmax-eVRQR-P2A-EGFP (LLH575)
Plasmid#242654PurposeCMV promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABEmax-VRQR-S55R-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE7.10 mutations in TadA, eVRQR mutations in SpC…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pV1200
Plasmid#111429PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS423-TyrSgH
Plasmid#163973PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Tyr) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-SgH
Plasmid#163972PurposeHelper plasmid for cloning gRNAs under the control of the SNR52 promoter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-ProSgH
Plasmid#163974PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Pro) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCT
Plasmid#60620PurposePlasmid encoding iCas9 and tracrRNA on pRS415 backboneDepositorInsertsiCas9
tracrRNA
UseCRISPRTagsFLAG and SV40 NLSExpressionYeastMutationchanged Aspartate 147 to Tyrosine, Proline 411 to…PromoterRPR1p and TEF1pAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only