We narrowed to 17,814 results for: multi
-
Plasmid#158222PurposeControl lentiviral plasmid encoding GFP-Nluc BRET reporter from Schaub et al., Cancer Research, 2015.DepositorInsertGFP-Nluc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
TK-GFP-Nluc-P2A-neo-TK
Plasmid#134896PurposeExpresses GFP protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum TK locusDepositorInsertTK-GFP-Nluc-P2A-Neo-TK
UseCryptosporidium expressionPromoterCryptosporidium actin and enolaseAvailable SinceNov. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-I
Plasmid#53439PurposeT7-dependent expression of the type-I agrB and agrD genes of S. aureus RN4220DepositorInsertagrBD locus
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationnonePromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV40 L1L2
Plasmid#52593PurposeExpresses HPV40 L1 and L2 in mammalian cellsDepositorInsertsHPV40 L1
HPV40 L2
ExpressionMammalianAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV70 L1L2
Plasmid#52603PurposeExpresses HPV70 L1 and L2 in mammalian cellsDepositorInsertsHPV70 L1
HPV70 L2
ExpressionMammalianAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV44 L1L2
Plasmid#52597PurposeExpresses HPV44 L1 and L2 in mammalian cellsDepositorInsertsHPV44 L1
HPV44 L2
ExpressionMammalianAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV26 L1L2
Plasmid#52601PurposeExpresses HPV26 L1 and L2 in mammalian cellsDepositorInsertsHPV26 L1
HPV26 L2
ExpressionMammalianAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJFRC156-21XUAS-B2RT>-dSTOP-B2RT>-myr::RFP
Plasmid#32135DepositorInsertB2RT> STOP STOP B2RT>
ExpressionInsectAvailable SinceNov. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
piggyBac-rtTA (4th_Gen)-SNCA(A53T)-sfGFP-IRES-NGN2-puro (VK_1123)
Plasmid#209080PurposeNgn2 mediated cortical neuron induction, along with SNCA(A53T)-sfGFP over-expressionDepositorTagssfGFPExpressionMammalianMutationA53TPromoterTRE4GAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaZ
Plasmid#196053PurposeEncodes a G alpha subunit (GNAZ) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry
Plasmid#170185PurposeExpression vector for a sgRNA against BFP and spCas9-Ec86 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Ec86 msr-msd region by SpeI and AvrII.DepositorInsertsEc86 RT
Retron Ec86 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianPromoterCBh and hU6Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPMQAK1-Ptrc-[E*](104)-Cas9-B0015-lacZ-PnrsB-mazF-LVA
Plasmid#190790Purpose[E*](104) construct. Theophylline inducible Cas9 (S. pyogenes) expression. Two BsaI-sites allow for simultaneous insertion of sgRNA and donor DNA. Includes a nickel-inducible curing system.DepositorInsertsCas9
mazF-LVA
UseCRISPR and Synthetic BiologyTagsLVAExpressionBacterialMutationsilent mutations of BpiI-sites in original Cas9 g…PromoterPnrsB and Ptrc-[E*](104)Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP 150TAG
Plasmid#197574PurposeFluorescence selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-150TAG and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertssfGFP 150TAG
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialMutationN150TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNASAM(gEmpty)-TREGFP-PGKpuroBFP-W
Plasmid#112926PurposeCRISPR-a reporter assay lentiviral vector (empty gRNA control)DepositorInserthU6-gRNASAM(empty), TREGFP, PGKpuroGFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRG01-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-WPRE
Plasmid#123362PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance and Firefly luciferase.DepositorInsertFirefly luciferase
UseCRISPR, Lentiviral, and LuciferaseExpressionMammalianPromoterEFSAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC0059 PbuCas13 (B03) His6-TwinStrep-SUMO-BsaI
Plasmid#115209PurposeExpresses PbuCas13b from a SUMO-tagged bacterial expression constructDepositorInsertPbuCas13
TagsSUMOExpressionBacterialAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTECH-MmAcK3RS(IPYE)
Plasmid#104071PurposeExpression plasmid encoding MmAcK3RS(IPYE) and pylTDepositorInsertPlpp MmAcK3RS(IPYE); PproK pyl
ExpressionBacterialMutationContains activating mutations V31I, T56P, H62Y, A…PromoterPlpp and PproKAvailable SinceDec. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
p11d-tRPA-32Ala9
Plasmid#102616PurposeExpression of human RPA with an alanine substituted phosphorylation domain (with the following mutations in RPA32 :S8,11-13,23,29,33,39A,T21A).DepositorExpressionBacterialMutationwith an alanine substituted phosphorylation domainPromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only