We narrowed to 28,961 results for: Tat
-
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
His6_BcLOV4_Q355N_mCherry_BamUK
Plasmid#119762PurposeEncodes mCherry-tagged BcLOV4 permanently-"lit" mutant with Q355N mutation for expression in bacterial cellDepositorInsertBcLOV4-Q355N_mCherry
TagsmCherryExpressionBacterialMutationMutated glutamine at position 355 to asparaginePromoterT7Available SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pET16better_H10_HRV3C_chitinase
Plasmid#175091PurposeExpresses B. licheniformis chitinase with an N terminal 10X His tag and HRV-3C cleavage site in E. coli.DepositorInsertchitinase
Tags10X His, HRV-3CExpressionBacterialAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-DIO-AppNL-G-F-P2A-EGFP
Plasmid#242648PurposeFloxed (DIO) AAV transgene designed to be packaged in AAV and to express the amyloid precursor protein (App) with familial mutations AppNL-G-F in a Cre-recombinase dependent manner.DepositorInsertFloxed (DOI) AAV transgene with human synapsin promoter driving amyloid precursor protein with familial mutations and EGFP tag
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFPExpressionMammalianPromoterhuman synapsinAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gal:mCherry-uTEV3
Plasmid#135453PurposeYeast expression of uTEV3 fused to mCherryDepositorInsertmCherry-uTEv3
TagsmCherryExpressionYeastMutationS219V mutation improves stability , I138T/S153N/T…PromoterGalAvailable SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMZ374
Plasmid#59896PurposeCombination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: Empty sgRNA target (CspCI placeholder) (see comments).DepositorInsertsCas9
rrk1:sgRNA
UseCRISPRExpressionYeastMutationSilent muation of the CspCI sitePromoteradh1 and rrk1Available SinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
NbV5-LgBit
Plasmid#201475PurposeNanoBit detection of V5-tagged proteinDepositorInsertNbV5-LgBit
TagsLgBitExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX-UBC_NKX2-1
Plasmid#221495PurposeNKX2-1 short isoform lentiviral overexpression using UBC promoterDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_HelperΔgIII
Plasmid#190433PurposeM13 helper genes cloned into the pSEVA631 vector, except the minor coat protein coding gene gIII (also called gp3, or g3p). This plasmid does not carry an M13 packaging signal.DepositorInsertM13 genes I-V and VII-XI
UseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LgBit-NbV5
Plasmid#201476PurposeNanoBit detection of V5-tagged proteinDepositorInsertLgBit-NbV5
TagsLgBitExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 sgBAK1
Plasmid#211520PurposeDeletes BAK1DepositorInsertsgBAK1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-CDS
Plasmid#136037PurposeUPF1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (AAGACACCTATTACACGAAGG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLSSmOrange-N1
Plasmid#37130DepositorInsertLSSmOrange
ExpressionMammalianMutationA44V/F84L/W145M/I165D/M167L/G202D compared to mOr…PromoterCMVAvailable SinceJune 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGST-EGFP-GPIBY55
Plasmid#213714PurposeExpress the affinity sorting tag GST-EGFP- GPIBY55.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGST-EGFP-GPIDAF
Plasmid#213713PurposeExpress the affinity sorting tag GST-EGFP- GPIDAF.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_Helper
Plasmid#190432PurposeM13 helper genes cloned into the pSEVA631 vector. This plasmid does not carry an M13 packaging signal. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ297.)DepositorInsertM13 genes: I-XI
UseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-emiRFP670
Plasmid#197200PurposeExpresses the protein of emiRFP670 in mammalian cellsDepositorHas ServiceAAV1InsertemiRFP670
UseAAVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
H2B-HT-mGold
Plasmid#183988PurposeExpresses fluorescent HaloTag7 fusion protein in mammalian cells with nuclear localization.DepositorAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only