We narrowed to 14,036 results for: TIM
-
Plasmid#76841Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PIK3C2A gRNA (BRDN0001149181)
Plasmid#76414Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001148547)
Plasmid#76415Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC1-dmito-oROS-HT
Plasmid#216418PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to mitochondrial matrix.DepositorInsertdmito-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEVA228-pro4IUPi
Plasmid#122018PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpro4Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PTRE-tight-flex-hM3Dq-mCherry-WPRE-pA
Plasmid#115161PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM3Dq receptor expression requires both neural activity and Cre recombinase.DepositorInsertsPTRE - tet activator responsive promoter
flex sequence
hM3dq-mCherry (inverted)
flex sequence
UseAAVTagshM3Dq-mCherryExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
CD3-2A_pMI-LO
Plasmid#153418PurposeRetroviral (MSCV) expression of all four WT CD3 subunits, co-expressed with LSSmOrangeDepositorInsertmurine CD3 delta-gamma-epsilon-zeta subunits (Cd3d Mouse)
UseRetroviralExpressionMammalianAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h1mut
Plasmid#86690PurposeFor transcription of of Suv4-20h1mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5B mutant (Kmt5b Mouse)
TagsHAMutationmutated region NHDC (asparagine 273 to cysteine 2…PromoterT3Available SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VQR-P2A-EGFP (RTW3520)
Plasmid#139990PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VQR(D1135V/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVQR=D1135V/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 proHB-EGF CS
Plasmid#11601DepositorInsertHB-EGF (HBEGF Human)
TagsHis and mycExpressionMammalianMutationConstitutively secreted HB-EGF: C-terminal amino …Available SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRER-P2A-EGFP (RTW3160)
Plasmid#139991PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRER(D1135V/G1218R/R1335E/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRER with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRER=D1135V/G1218R/R1335E/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-LSSmOrange
Plasmid#110197PurposeEncodes for human CXCR4 coding sequence tagged with the LSS-mOrange FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FLAG-Akt2-CA
Plasmid#64050PurposeMyristoylated-FLAG-tagged Akt2, constitutively activeDepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC1-oROS-HT-CaaX
Plasmid#216417PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the intracellular site of cell membranes.DepositorInsertoROS-HT-CaaX
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-3xFLAG-YAP1-S127A
Plasmid#42239DepositorInsertYAP1 (YAP1 Human)
UseGatewayTags3xFLAGMutationSerine 127 changed to alaninePromoternoneAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001149263)
Plasmid#76843Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-HA-CAD S1859A
Plasmid#46239PurposeFLAG-HA-CAD with S1859 phosphorylation site mutated to alanineDepositorInsertcarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad Mouse)
TagsFLAG and HAExpressionMammalianMutationSerine 1859 changed to Alanine (S1859A)PromotercmvAvailable SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only